Incidental Mutation 'R6979:Dmxl2'
ID542617
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene NameDmx-like 2
SynonymsE130119P06Rik, 6430411K14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6979 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location54365158-54501626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54450879 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 512 (I512T)
Ref Sequence ENSEMBL: ENSMUSP00000113705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600] [ENSMUST00000127880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118163
AA Change: I512T

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: I512T

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118600
AA Change: I512T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: I512T

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127880
AA Change: I338T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122293
Gene: ENSMUSG00000041268
AA Change: I338T

DomainStartEndE-ValueType
Pfam:WD40 1 24 7.9e-4 PFAM
WD40 47 95 1.03e-1 SMART
low complexity region 246 266 N/A INTRINSIC
WD40 567 619 1.42e2 SMART
low complexity region 687 701 N/A INTRINSIC
low complexity region 771 787 N/A INTRINSIC
WD40 811 855 1.15e1 SMART
WD40 1062 1099 2.84e2 SMART
low complexity region 1252 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C T 3: 60,040,003 T374M probably benign Het
Aspg A G 12: 112,120,944 D278G possibly damaging Het
Aspm C A 1: 139,480,485 A2370E probably damaging Het
Ccnt2 T C 1: 127,775,136 M65T probably damaging Het
Cd163 A G 6: 124,317,986 T670A probably benign Het
Cpne3 G A 4: 19,533,098 T279I probably benign Het
Ctdspl G A 9: 119,040,530 V227M probably damaging Het
Ctnnd2 A G 15: 30,619,230 E99G probably damaging Het
Dapk1 T C 13: 60,748,281 S728P probably damaging Het
Dopey1 A T 9: 86,521,642 T1630S possibly damaging Het
Dqx1 A G 6: 83,061,011 D460G probably damaging Het
Foxg1 T C 12: 49,384,784 probably benign Het
H2-Q2 T A 17: 35,345,647 probably null Het
Hes6 T C 1: 91,413,088 E17G possibly damaging Het
Ighv1-42 T C 12: 114,937,228 Y79C possibly damaging Het
Itfg2 T C 6: 128,411,591 D311G probably damaging Het
Itgb5 T A 16: 33,919,986 C489S probably damaging Het
Map4k5 A T 12: 69,822,848 C488S probably damaging Het
Mark1 C T 1: 184,912,628 G377D possibly damaging Het
Mat2a A G 6: 72,435,113 V318A probably damaging Het
Mpp7 T G 18: 7,355,049 N459T possibly damaging Het
Mrc2 C A 11: 105,348,635 N1348K probably damaging Het
Mroh5 T C 15: 73,793,129 K264R probably benign Het
Mtor A G 4: 148,524,473 M1529V possibly damaging Het
Mtrr C T 13: 68,570,003 probably null Het
Nwd1 C T 8: 72,667,660 P517L probably damaging Het
Olfr1100 A G 2: 86,978,233 S188P probably damaging Het
Olfr1197 T A 2: 88,729,184 R138S probably benign Het
Polr1c A G 17: 46,246,169 F63L probably damaging Het
Polrmt C T 10: 79,746,566 probably null Het
Pomt2 T C 12: 87,130,351 I287M probably damaging Het
Prkar2a T A 9: 108,733,143 N190K possibly damaging Het
Prl3d3 T A 13: 27,157,562 Y59N possibly damaging Het
Prl5a1 T A 13: 28,151,206 F199L probably benign Het
Prpf38b A G 3: 108,911,324 V40A probably benign Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptgs1 A G 2: 36,251,299 D586G probably benign Het
Slx4 T C 16: 3,985,015 K1312E probably damaging Het
Smok3c A G 5: 138,064,725 D158G probably benign Het
Spen A T 4: 141,478,063 D1084E unknown Het
Tcp11l1 C T 2: 104,706,439 G27D probably benign Het
Tep1 A G 14: 50,838,637 S1679P possibly damaging Het
Tmem259 C T 10: 79,978,557 V322I possibly damaging Het
Tmpo A T 10: 91,152,497 probably null Het
Ttn C A 2: 76,724,793 A30623S probably damaging Het
Ube2l3 G A 16: 17,159,977 probably benign Het
Unkl A G 17: 25,199,916 D146G probably damaging Het
Vmn1r51 A T 6: 90,129,204 H34L possibly damaging Het
Vmn2r17 A G 5: 109,428,399 T379A possibly damaging Het
Zfp35 G T 18: 24,003,870 G424C probably benign Het
Zfp420 T A 7: 29,876,021 H555Q probably damaging Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54401704 missense probably benign
IGL00226:Dmxl2 APN 9 54415993 missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54406667 missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54450838 missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54415422 unclassified probably benign
IGL00852:Dmxl2 APN 9 54423313 nonsense probably null
IGL00857:Dmxl2 APN 9 54376320 missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54416882 missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54458964 missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54415475 missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54445376 splice site probably benign
IGL01645:Dmxl2 APN 9 54378733 missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54401065 missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54404015 nonsense probably null
IGL02145:Dmxl2 APN 9 54374697 missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54404049 missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54445433 missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54393768 missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54393843 missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54393748 missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54406615 missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54366414 utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54416945 missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54404172 missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54416371 missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54404220 missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54446672 missense probably damaging 1.00
BB003:Dmxl2 UTSW 9 54428042 missense probably benign 0.01
BB013:Dmxl2 UTSW 9 54428042 missense probably benign 0.01
I2288:Dmxl2 UTSW 9 54401793 missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54401764 missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54378939 missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54399940 critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54416951 missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54383750 missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54393836 missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54405906 missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54419945 missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54382702 missense probably benign
R0626:Dmxl2 UTSW 9 54416554 missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54378817 missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54405828 missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54366440 missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54446412 missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54367765 missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54416433 missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54396249 missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54415428 critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54446988 nonsense probably null
R1609:Dmxl2 UTSW 9 54409263 missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54382027 missense probably benign
R1660:Dmxl2 UTSW 9 54451030 missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54401485 missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54423224 splice site probably benign
R1832:Dmxl2 UTSW 9 54460949 missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54401523 missense probably benign
R2104:Dmxl2 UTSW 9 54415564 missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54393813 missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54415910 missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54376243 missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54393862 missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54400094 missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54393702 missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54477461 missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54393643 missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54393769 missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54369878 missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54473832 splice site probably benign
R4004:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54379013 splice site probably null
R4014:Dmxl2 UTSW 9 54378709 splice site probably null
R4115:Dmxl2 UTSW 9 54446988 nonsense probably null
R4232:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54396267 missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54419884 missense probably null 0.17
R4552:Dmxl2 UTSW 9 54451763 missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54446512 missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54404120 missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54446905 missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54450924 missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54446405 splice site probably null
R4746:Dmxl2 UTSW 9 54451796 missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54379815 missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54404041 missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54411653 missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54501441 utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54460987 missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54445484 splice site probably null
R5288:Dmxl2 UTSW 9 54378757 missense probably benign
R5373:Dmxl2 UTSW 9 54369189 intron probably benign
R5374:Dmxl2 UTSW 9 54369189 intron probably benign
R5385:Dmxl2 UTSW 9 54378757 missense probably benign
R5386:Dmxl2 UTSW 9 54378757 missense probably benign
R5418:Dmxl2 UTSW 9 54374651 critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54393857 missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54423359 splice site probably null
R5733:Dmxl2 UTSW 9 54376266 missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54472964 missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54375508 missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54387420 missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54416753 missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54393727 missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54415762 missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54382706 missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54375536 missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54411624 missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54416088 missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54409183 missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54480380 missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54472212 missense probably damaging 1.00
R7147:Dmxl2 UTSW 9 54416729 missense probably benign 0.06
R7327:Dmxl2 UTSW 9 54401585 missense probably damaging 1.00
R7462:Dmxl2 UTSW 9 54366632 splice site probably null
R7526:Dmxl2 UTSW 9 54400957 missense possibly damaging 0.47
R7569:Dmxl2 UTSW 9 54415987 missense possibly damaging 0.51
R7622:Dmxl2 UTSW 9 54472218 missense probably damaging 0.99
R7638:Dmxl2 UTSW 9 54457794 missense unknown
R7703:Dmxl2 UTSW 9 54461086 missense probably benign 0.01
R7768:Dmxl2 UTSW 9 54380939 missense probably damaging 1.00
R7926:Dmxl2 UTSW 9 54428042 missense probably benign 0.01
R7969:Dmxl2 UTSW 9 54446881 missense possibly damaging 0.85
R8007:Dmxl2 UTSW 9 54383691 nonsense probably null
R8200:Dmxl2 UTSW 9 54480346 missense probably benign
R8311:Dmxl2 UTSW 9 54446933 missense probably benign 0.00
R8320:Dmxl2 UTSW 9 54383759 missense probably benign
R8377:Dmxl2 UTSW 9 54378748 missense probably damaging 1.00
R8400:Dmxl2 UTSW 9 54383753 missense probably benign 0.03
R8509:Dmxl2 UTSW 9 54428057 nonsense probably null
X0064:Dmxl2 UTSW 9 54401713 missense probably benign
Z1177:Dmxl2 UTSW 9 54382034 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGTGTAGGTGAATGCCAGG -3'
(R):5'- ATCTGAGGCAGGTACAGGATC -3'

Sequencing Primer
(F):5'- TGAATGCCAGGGCCAGG -3'
(R):5'- CAGGTACAGGATCATCAGAACATG -3'
Posted On2018-11-28