Incidental Mutation 'R6979:Prl5a1'
ID542629
Institutional Source Beutler Lab
Gene Symbol Prl5a1
Ensembl Gene ENSMUSG00000017064
Gene Nameprolactin family 5, subfamily a, member 1
SynonymsD13Wsu14e, 1600013P04Rik, Prlpl, PLP-L
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6979 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location28142484-28151611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28151206 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 199 (F199L)
Ref Sequence ENSEMBL: ENSMUSP00000017208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017208]
Predicted Effect probably benign
Transcript: ENSMUST00000017208
AA Change: F199L

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000017208
Gene: ENSMUSG00000017064
AA Change: F199L

DomainStartEndE-ValueType
Pfam:Hormone_1 17 230 4.8e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C T 3: 60,040,003 T374M probably benign Het
Aspg A G 12: 112,120,944 D278G possibly damaging Het
Aspm C A 1: 139,480,485 A2370E probably damaging Het
Ccnt2 T C 1: 127,775,136 M65T probably damaging Het
Cd163 A G 6: 124,317,986 T670A probably benign Het
Cpne3 G A 4: 19,533,098 T279I probably benign Het
Ctdspl G A 9: 119,040,530 V227M probably damaging Het
Ctnnd2 A G 15: 30,619,230 E99G probably damaging Het
Dapk1 T C 13: 60,748,281 S728P probably damaging Het
Dmxl2 A G 9: 54,450,879 I512T possibly damaging Het
Dopey1 A T 9: 86,521,642 T1630S possibly damaging Het
Dqx1 A G 6: 83,061,011 D460G probably damaging Het
Foxg1 T C 12: 49,384,784 probably benign Het
H2-Q2 T A 17: 35,345,647 probably null Het
Hes6 T C 1: 91,413,088 E17G possibly damaging Het
Ighv1-42 T C 12: 114,937,228 Y79C possibly damaging Het
Itfg2 T C 6: 128,411,591 D311G probably damaging Het
Itgb5 T A 16: 33,919,986 C489S probably damaging Het
Map4k5 A T 12: 69,822,848 C488S probably damaging Het
Mark1 C T 1: 184,912,628 G377D possibly damaging Het
Mat2a A G 6: 72,435,113 V318A probably damaging Het
Mpp7 T G 18: 7,355,049 N459T possibly damaging Het
Mrc2 C A 11: 105,348,635 N1348K probably damaging Het
Mroh5 T C 15: 73,793,129 K264R probably benign Het
Mtor A G 4: 148,524,473 M1529V possibly damaging Het
Mtrr C T 13: 68,570,003 probably null Het
Nwd1 C T 8: 72,667,660 P517L probably damaging Het
Olfr1100 A G 2: 86,978,233 S188P probably damaging Het
Olfr1197 T A 2: 88,729,184 R138S probably benign Het
Polr1c A G 17: 46,246,169 F63L probably damaging Het
Polrmt C T 10: 79,746,566 probably null Het
Pomt2 T C 12: 87,130,351 I287M probably damaging Het
Prkar2a T A 9: 108,733,143 N190K possibly damaging Het
Prl3d3 T A 13: 27,157,562 Y59N possibly damaging Het
Prpf38b A G 3: 108,911,324 V40A probably benign Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptgs1 A G 2: 36,251,299 D586G probably benign Het
Slx4 T C 16: 3,985,015 K1312E probably damaging Het
Smok3c A G 5: 138,064,725 D158G probably benign Het
Spen A T 4: 141,478,063 D1084E unknown Het
Tcp11l1 C T 2: 104,706,439 G27D probably benign Het
Tep1 A G 14: 50,838,637 S1679P possibly damaging Het
Tmem259 C T 10: 79,978,557 V322I possibly damaging Het
Tmpo A T 10: 91,152,497 probably null Het
Ttn C A 2: 76,724,793 A30623S probably damaging Het
Ube2l3 G A 16: 17,159,977 probably benign Het
Unkl A G 17: 25,199,916 D146G probably damaging Het
Vmn1r51 A T 6: 90,129,204 H34L possibly damaging Het
Vmn2r17 A G 5: 109,428,399 T379A possibly damaging Het
Zfp35 G T 18: 24,003,870 G424C probably benign Het
Zfp420 T A 7: 29,876,021 H555Q probably damaging Het
Other mutations in Prl5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Prl5a1 APN 13 28145439 missense possibly damaging 0.77
IGL01820:Prl5a1 APN 13 28148700 missense probably benign 0.34
IGL02682:Prl5a1 APN 13 28145420 missense probably benign 0.32
R0266:Prl5a1 UTSW 13 28149987 missense possibly damaging 0.77
R1022:Prl5a1 UTSW 13 28149897 missense probably damaging 0.97
R1024:Prl5a1 UTSW 13 28149897 missense probably damaging 0.97
R2098:Prl5a1 UTSW 13 28145505 missense probably damaging 1.00
R5467:Prl5a1 UTSW 13 28150011 missense possibly damaging 0.92
R6002:Prl5a1 UTSW 13 28145482 missense probably benign 0.00
R6026:Prl5a1 UTSW 13 28151264 missense probably benign 0.43
R6242:Prl5a1 UTSW 13 28142555 nonsense probably null
R6616:Prl5a1 UTSW 13 28149856 missense probably benign 0.00
R6733:Prl5a1 UTSW 13 28149936 missense possibly damaging 0.81
R7692:Prl5a1 UTSW 13 28150014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGTCTACATACATGAAACACGTG -3'
(R):5'- AGTGACCCTTTAGATTTAATCACAC -3'

Sequencing Primer
(F):5'- ACTGGCTGACTTTTATTTGG -3'
(R):5'- CTGCCCCAGAAATAGATAGG -3'
Posted On2018-11-28