Incidental Mutation 'R6979:Polr1c'
ID542639
Institutional Source Beutler Lab
Gene Symbol Polr1c
Ensembl Gene ENSMUSG00000067148
Gene Namepolymerase (RNA) I polypeptide C
SynonymsRPA40, Rpo1-1, 40kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6979 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46243920-46248054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46246169 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 63 (F63L)
Ref Sequence ENSEMBL: ENSMUSP00000133597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000087031] [ENSMUST00000095263] [ENSMUST00000123311] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087026
AA Change: F63L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148
AA Change: F63L

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087031
SMART Domains Protein: ENSMUSP00000084257
Gene: ENSMUSG00000067150

DomainStartEndE-ValueType
IBN_N 33 100 6.73e-3 SMART
Pfam:Xpo1 109 271 1.4e-34 PFAM
low complexity region 326 342 N/A INTRINSIC
low complexity region 770 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095263
SMART Domains Protein: ENSMUSP00000092897
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123311
SMART Domains Protein: ENSMUSP00000115951
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127378
SMART Domains Protein: ENSMUSP00000114937
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
Pfam:Yip1 30 178 4.6e-13 PFAM
low complexity region 189 201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142706
AA Change: F63L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148
AA Change: F63L

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173232
AA Change: F63L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148
AA Change: F63L

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173349
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of both RNA polymerase I and RNA polymerase III complexes. The encoded protein is part of the Pol core element. Mutations in this gene have been associated with Treacher Collins syndrome (TCS) and hypomyelinating leukodystrophy 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C T 3: 60,040,003 T374M probably benign Het
Aspg A G 12: 112,120,944 D278G possibly damaging Het
Aspm C A 1: 139,480,485 A2370E probably damaging Het
Ccnt2 T C 1: 127,775,136 M65T probably damaging Het
Cd163 A G 6: 124,317,986 T670A probably benign Het
Cpne3 G A 4: 19,533,098 T279I probably benign Het
Ctdspl G A 9: 119,040,530 V227M probably damaging Het
Ctnnd2 A G 15: 30,619,230 E99G probably damaging Het
Dapk1 T C 13: 60,748,281 S728P probably damaging Het
Dmxl2 A G 9: 54,450,879 I512T possibly damaging Het
Dopey1 A T 9: 86,521,642 T1630S possibly damaging Het
Dqx1 A G 6: 83,061,011 D460G probably damaging Het
Foxg1 T C 12: 49,384,784 probably benign Het
H2-Q2 T A 17: 35,345,647 probably null Het
Hes6 T C 1: 91,413,088 E17G possibly damaging Het
Ighv1-42 T C 12: 114,937,228 Y79C possibly damaging Het
Itfg2 T C 6: 128,411,591 D311G probably damaging Het
Itgb5 T A 16: 33,919,986 C489S probably damaging Het
Map4k5 A T 12: 69,822,848 C488S probably damaging Het
Mark1 C T 1: 184,912,628 G377D possibly damaging Het
Mat2a A G 6: 72,435,113 V318A probably damaging Het
Mpp7 T G 18: 7,355,049 N459T possibly damaging Het
Mrc2 C A 11: 105,348,635 N1348K probably damaging Het
Mroh5 T C 15: 73,793,129 K264R probably benign Het
Mtor A G 4: 148,524,473 M1529V possibly damaging Het
Mtrr C T 13: 68,570,003 probably null Het
Nwd1 C T 8: 72,667,660 P517L probably damaging Het
Olfr1100 A G 2: 86,978,233 S188P probably damaging Het
Olfr1197 T A 2: 88,729,184 R138S probably benign Het
Polrmt C T 10: 79,746,566 probably null Het
Pomt2 T C 12: 87,130,351 I287M probably damaging Het
Prkar2a T A 9: 108,733,143 N190K possibly damaging Het
Prl3d3 T A 13: 27,157,562 Y59N possibly damaging Het
Prl5a1 T A 13: 28,151,206 F199L probably benign Het
Prpf38b A G 3: 108,911,324 V40A probably benign Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptgs1 A G 2: 36,251,299 D586G probably benign Het
Slx4 T C 16: 3,985,015 K1312E probably damaging Het
Smok3c A G 5: 138,064,725 D158G probably benign Het
Spen A T 4: 141,478,063 D1084E unknown Het
Tcp11l1 C T 2: 104,706,439 G27D probably benign Het
Tep1 A G 14: 50,838,637 S1679P possibly damaging Het
Tmem259 C T 10: 79,978,557 V322I possibly damaging Het
Tmpo A T 10: 91,152,497 probably null Het
Ttn C A 2: 76,724,793 A30623S probably damaging Het
Ube2l3 G A 16: 17,159,977 probably benign Het
Unkl A G 17: 25,199,916 D146G probably damaging Het
Vmn1r51 A T 6: 90,129,204 H34L possibly damaging Het
Vmn2r17 A G 5: 109,428,399 T379A possibly damaging Het
Zfp35 G T 18: 24,003,870 G424C probably benign Het
Zfp420 T A 7: 29,876,021 H555Q probably damaging Het
Other mutations in Polr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Polr1c APN 17 46244209 missense probably damaging 1.00
IGL02035:Polr1c APN 17 46246159 missense possibly damaging 0.72
R0068:Polr1c UTSW 17 46244903 missense probably benign 0.00
R0457:Polr1c UTSW 17 46247763 missense probably benign 0.00
R0828:Polr1c UTSW 17 46245064 missense probably damaging 0.96
R0881:Polr1c UTSW 17 46244613 missense possibly damaging 0.69
R1322:Polr1c UTSW 17 46244163 missense possibly damaging 0.74
R1518:Polr1c UTSW 17 46247895 missense possibly damaging 0.89
R3765:Polr1c UTSW 17 46247924 missense probably damaging 0.99
R4212:Polr1c UTSW 17 46246120 missense probably damaging 0.97
R4548:Polr1c UTSW 17 46247809 splice site probably null
R5017:Polr1c UTSW 17 46247709 intron probably benign
R5018:Polr1c UTSW 17 46247709 intron probably benign
R5039:Polr1c UTSW 17 46247709 intron probably benign
R5167:Polr1c UTSW 17 46247709 intron probably benign
R5168:Polr1c UTSW 17 46247709 intron probably benign
R5971:Polr1c UTSW 17 46247709 intron probably benign
R7812:Polr1c UTSW 17 46246127 missense probably damaging 1.00
R7869:Polr1c UTSW 17 46244891 missense probably benign 0.00
R8025:Polr1c UTSW 17 46245048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCAGACTGTCATAGGTG -3'
(R):5'- CAAACGGTCTAAGTAGTGTGGG -3'

Sequencing Primer
(F):5'- CCAGACTGTCATAGGTGTGAACC -3'
(R):5'- TAATCCCAGTACTTGGTAGGCAG -3'
Posted On2018-11-28