Mutagenetix > Incidental Mutations

Incidental Mutation 'R6981:Arhgef4'

542645

Institutional Source

Beutler Lab

Gene Symbol

Arhgef4

Ensembl Gene

ENSMUSG00000037509

Gene Name

Rho guanine nucleotide exchange factor (GEF) 4

Synonyms

9330140K16Rik, Asef

MMRRC Submission

Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6981 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34678188-34813309 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 34722452 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Proline at position 263 (Q263P)

Ref Sequence

ENSEMBL: ENSMUSP00000124213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159747]

AlphaFold

Q7TNR9

Predicted Effect

unknown
Transcript: ENSMUST00000159747
AA Change: Q263P

SMART Domains

Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: Q263P

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	686	712	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1119	1137	N/A	INTRINSIC
low complexity region	1240	1254	N/A	INTRINSIC
SH3	1361	1416	3.73e-16	SMART
RhoGEF	1453	1632	3.86e-56	SMART
PH	1665	1773	2.33e-14	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	A	11: 58,293,718		probably benign	Het
5031439G07Rik	A	C	15: 84,949,597	Y419*	probably null	Het
Abca2	T	A	2: 25,444,139	F1809L	probably damaging	Het
Ache	C	T	5: 137,291,678	T423I	probably benign	Het
Acvrl1	A	G	15: 101,138,345	T395A	probably damaging	Het
Ap3b2	A	G	7: 81,477,993	I145T	probably damaging	Het
Asgr2	C	T	11: 70,096,810	L45F	probably damaging	Het
Baiap2l1	T	A	5: 144,285,579	Y122F	possibly damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Car8	A	T	4: 8,185,650		probably null	Het
Carns1	T	C	19: 4,170,082	T385A	probably benign	Het
Ccdc47	T	C	11: 106,202,737	T41A	probably benign	Het
Ccne1	A	T	7: 38,098,573		probably benign	Het
Cdh4	C	T	2: 179,797,504	T148I	probably benign	Het
Cep85	C	T	4: 134,152,261	R392Q	probably damaging	Het
Ces1h	T	C	8: 93,353,495	T464A	unknown	Het
Cfl1	T	A	19: 5,492,616	S41R	possibly damaging	Het
Crnn	T	C	3: 93,148,135	V76A	probably damaging	Het
Cspg4	A	G	9: 56,887,101	T707A	probably benign	Het
Dgkh	A	T	14: 78,627,742	C53*	probably null	Het
Dhx34	G	T	7: 16,215,330	A391E	possibly damaging	Het
Dlx1	C	A	2: 71,532,353	N201K	probably benign	Het
Dnah6	T	C	6: 73,021,178	E4087G	probably benign	Het
Dock6	T	C	9: 21,845,550	Y134C	probably damaging	Het
Duox2	A	G	2: 122,291,227	V662A	possibly damaging	Het
Dusp12	A	G	1: 170,880,961	F12L	probably damaging	Het
Eppk1	T	C	15: 76,111,037	E548G	probably benign	Het
Foxj2	A	G	6: 122,828,444	I92V	probably damaging	Het
Foxj2	A	G	6: 122,842,839	D562G	probably benign	Het
Gm17728	A	G	17: 9,422,159	R34G	probably damaging	Het
Gpc6	T	C	14: 117,624,548	I292T	probably damaging	Het
Gpr15	T	A	16: 58,718,185	K180N	probably benign	Het
Gtf2ird1	G	T	5: 134,383,922		probably benign	Het
Hist1h2ah	A	G	13: 22,035,549	S2P	probably benign	Het
Hps3	T	A	3: 20,022,820	T393S	probably damaging	Het
Hspa1a	A	T	17: 34,970,291		probably null	Het
Hydin	A	G	8: 110,531,072	E2378G	possibly damaging	Het
Ighv1-18	A	G	12: 114,682,678	L102P	probably damaging	Het
Itga5	T	A	15: 103,350,226	N814I	probably benign	Het
Kcnb2	T	C	1: 15,710,256	S451P	probably damaging	Het
Klhl32	T	G	4: 24,709,030	I112L	probably damaging	Het
Knstrn	T	G	2: 118,834,094	I47R	possibly damaging	Het
Med23	T	A	10: 24,895,824	S581T	possibly damaging	Het
Mgat5	C	T	1: 127,390,851	T361I	probably damaging	Het
Nipal3	A	G	4: 135,479,547	V112A	probably damaging	Het
Olfr1287	T	C	2: 111,449,352	F71L	probably benign	Het
Olfr1359	A	G	13: 21,703,073	E24G	probably benign	Het
Olfr713	T	A	7: 107,036,749	V198D	possibly damaging	Het
Olfr996	A	G	2: 85,579,481	M81V	probably benign	Het
Paxip1	G	A	5: 27,765,768	Q528*	probably null	Het
Proser2	T	C	2: 6,113,990	D14G	probably damaging	Het
Rp1	T	G	1: 4,345,655	I1745L	probably benign	Het
Rxfp2	G	T	5: 150,048,848		probably null	Het
Slc45a1	T	C	4: 150,638,594	S278G	possibly damaging	Het
Smurf1	A	G	5: 144,886,369	I455T	possibly damaging	Het
Speg	T	C	1: 75,430,913	L3188P	probably damaging	Het
Tcaf3	G	T	6: 42,597,125	A51D	probably damaging	Het
Tecrl	T	C	5: 83,354,921	N12S	possibly damaging	Het
Tmem17	T	A	11: 22,518,508	I149N	possibly damaging	Het
Tmem171	A	G	13: 98,692,468	V58A	possibly damaging	Het
Ttn	A	G	2: 76,861,177		probably benign	Het
Ubqln5	A	G	7: 104,128,601	S339P	probably benign	Het
Vmn1r16	T	A	6: 57,323,488	I50L	probably benign	Het
Vmn2r103	A	T	17: 19,793,477	Y177F	probably benign	Het
Zfp28	C	A	7: 6,394,693	T709K	probably damaging	Het
Zfp958	A	G	8: 4,626,170	N46S	probably benign	Het
Zyx	T	A	6: 42,350,357	V30E	unknown	Het

Other mutations in Arhgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Arhgef4	APN	1	34811696	missense	possibly damaging	0.88
IGL02376:Arhgef4	APN	1	34806059	missense	probably damaging	1.00
IGL02604:Arhgef4	APN	1	34811723	nonsense	probably null
IGL03240:Arhgef4	APN	1	34806026	missense	probably benign	0.03
BB004:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
BB014:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R0095:Arhgef4	UTSW	1	34732370	nonsense	probably null
R0157:Arhgef4	UTSW	1	34806394	missense	probably damaging	1.00
R0243:Arhgef4	UTSW	1	34806999	splice site	probably null
R0383:Arhgef4	UTSW	1	34810533	missense	probably damaging	1.00
R0440:Arhgef4	UTSW	1	34745448	splice site	probably null
R0452:Arhgef4	UTSW	1	34732322	missense	probably damaging	0.97
R0893:Arhgef4	UTSW	1	34807110	missense	probably damaging	1.00
R1429:Arhgef4	UTSW	1	34810339	missense	probably damaging	1.00
R1437:Arhgef4	UTSW	1	34723945	missense	unknown
R1669:Arhgef4	UTSW	1	34732158	missense	possibly damaging	0.86
R1780:Arhgef4	UTSW	1	34724160	missense	possibly damaging	0.73
R1809:Arhgef4	UTSW	1	34810555	critical splice donor site	probably null
R1879:Arhgef4	UTSW	1	34722440	missense	unknown
R1908:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01
R1919:Arhgef4	UTSW	1	34811140	missense	probably damaging	0.98
R2020:Arhgef4	UTSW	1	34723810	missense	unknown
R2058:Arhgef4	UTSW	1	34722377	missense	unknown
R2213:Arhgef4	UTSW	1	34807149	splice site	probably null
R2851:Arhgef4	UTSW	1	34724048	missense	unknown
R2852:Arhgef4	UTSW	1	34724048	missense	unknown
R2853:Arhgef4	UTSW	1	34724048	missense	unknown
R3697:Arhgef4	UTSW	1	34722440	missense	unknown
R4012:Arhgef4	UTSW	1	34725106	missense	possibly damaging	0.75
R4118:Arhgef4	UTSW	1	34732347	missense	probably damaging	0.98
R4133:Arhgef4	UTSW	1	34806104	missense	probably damaging	1.00
R4534:Arhgef4	UTSW	1	34723081	missense	unknown
R4535:Arhgef4	UTSW	1	34723081	missense	unknown
R4581:Arhgef4	UTSW	1	34732124	missense	possibly damaging	0.83
R4665:Arhgef4	UTSW	1	34806032	missense	possibly damaging	0.89
R4678:Arhgef4	UTSW	1	34722668	missense	unknown
R4684:Arhgef4	UTSW	1	34811785	splice site	probably null
R4706:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
R4745:Arhgef4	UTSW	1	34807275	missense	probably damaging	1.00
R4747:Arhgef4	UTSW	1	34723274	missense	unknown
R4988:Arhgef4	UTSW	1	34723454	missense	unknown
R5063:Arhgef4	UTSW	1	34724215	missense	probably benign	0.00
R5154:Arhgef4	UTSW	1	34732374	missense	probably benign	0.43
R5156:Arhgef4	UTSW	1	34723274	missense	unknown
R5263:Arhgef4	UTSW	1	34724997	missense	possibly damaging	0.84
R5450:Arhgef4	UTSW	1	34807324	intron	probably benign
R5807:Arhgef4	UTSW	1	34807615	intron	probably benign
R5863:Arhgef4	UTSW	1	34722845	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6311:Arhgef4	UTSW	1	34723981	missense	unknown
R6315:Arhgef4	UTSW	1	34723477	missense	unknown
R6316:Arhgef4	UTSW	1	34723477	missense	unknown
R6318:Arhgef4	UTSW	1	34723477	missense	unknown
R6323:Arhgef4	UTSW	1	34723477	missense	unknown
R6324:Arhgef4	UTSW	1	34723477	missense	unknown
R6325:Arhgef4	UTSW	1	34723477	missense	unknown
R6340:Arhgef4	UTSW	1	34732223	missense	probably damaging	1.00
R6835:Arhgef4	UTSW	1	34806493	missense	probably damaging	1.00
R7087:Arhgef4	UTSW	1	34811686	missense	probably damaging	0.96
R7297:Arhgef4	UTSW	1	34807192	missense	probably damaging	1.00
R7525:Arhgef4	UTSW	1	34809704	missense	probably damaging	1.00
R7614:Arhgef4	UTSW	1	34732235	missense	possibly damaging	0.67
R7693:Arhgef4	UTSW	1	34724141	missense	probably benign	0.01
R7892:Arhgef4	UTSW	1	34721804	missense	unknown
R7895:Arhgef4	UTSW	1	34806397	missense	probably damaging	1.00
R7927:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R7965:Arhgef4	UTSW	1	34811681	missense	probably benign
R7973:Arhgef4	UTSW	1	34724437	missense	possibly damaging	0.83
R7979:Arhgef4	UTSW	1	34721897	missense	unknown
R8160:Arhgef4	UTSW	1	34723574	missense	unknown
R8175:Arhgef4	UTSW	1	34810374	missense	probably benign
R8178:Arhgef4	UTSW	1	34722902	missense	unknown
R9046:Arhgef4	UTSW	1	34811765	missense	possibly damaging	0.92
R9077:Arhgef4	UTSW	1	34721743	missense	unknown
R9209:Arhgef4	UTSW	1	34725160	critical splice donor site	probably null
R9209:Arhgef4	UTSW	1	34810495	missense	probably benign
R9355:Arhgef4	UTSW	1	34810549	missense	probably benign	0.02
RF012:Arhgef4	UTSW	1	34724484	small deletion	probably benign
X0062:Arhgef4	UTSW	1	34724227	missense	probably benign	0.35
YA93:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
Z1176:Arhgef4	UTSW	1	34723729	missense	unknown
Z1176:Arhgef4	UTSW	1	34804926	missense	probably damaging	1.00
Z1177:Arhgef4	UTSW	1	34722921	missense	unknown
Z1177:Arhgef4	UTSW	1	34723366	missense	unknown
Z1177:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCTTTCGTCGACACTGTG -3'
(R):5'- GCAAGTAGGGCCAATTTGTACC -3'

Sequencing Primer
(F):5'- TCGTCGACACTGTGAACTAG -3'
(R):5'- AAGTAGGGCCAATTTGTACCTTTCTG -3'

Posted On

2018-11-28