Mutagenetix > Incidental Mutation

Incidental Mutation 'R6981:Mgat5'

542647

Institutional Source

Beutler Lab

Gene Symbol

Mgat5

Ensembl Gene

ENSMUSG00000036155

Gene Name

mannoside acetylglucosaminyltransferase 5

Synonyms

4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6981 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127205015-127488336 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127390851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 361 (T361I)

Ref Sequence

ENSEMBL: ENSMUSP00000129166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]

AlphaFold

Q8R4G6

Predicted Effect

probably damaging
Transcript: ENSMUST00000038361
AA Change: T361I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: T361I

Domain	Start	End	E-Value	Type
Pfam:DUF4525	2	138	3.4e-70	PFAM
Pfam:Glyco_transf_18	171	725	9.8e-268	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171405
AA Change: T361I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: T361I

Domain	Start	End	E-Value	Type
Pfam:DUF4525	3	137	9.3e-64	PFAM
Pfam:Glyco_transf_18	171	725	1.9e-268	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	A	11: 58,293,718		probably benign	Het
5031439G07Rik	A	C	15: 84,949,597	Y419*	probably null	Het
Abca2	T	A	2: 25,444,139	F1809L	probably damaging	Het
Ache	C	T	5: 137,291,678	T423I	probably benign	Het
Acvrl1	A	G	15: 101,138,345	T395A	probably damaging	Het
Ap3b2	A	G	7: 81,477,993	I145T	probably damaging	Het
Arhgef4	A	C	1: 34,722,452	Q263P	unknown	Het
Asgr2	C	T	11: 70,096,810	L45F	probably damaging	Het
Baiap2l1	T	A	5: 144,285,579	Y122F	possibly damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Car8	A	T	4: 8,185,650		probably null	Het
Carns1	T	C	19: 4,170,082	T385A	probably benign	Het
Ccdc47	T	C	11: 106,202,737	T41A	probably benign	Het
Ccne1	A	T	7: 38,098,573		probably benign	Het
Cdh4	C	T	2: 179,797,504	T148I	probably benign	Het
Cep85	C	T	4: 134,152,261	R392Q	probably damaging	Het
Ces1h	T	C	8: 93,353,495	T464A	unknown	Het
Cfl1	T	A	19: 5,492,616	S41R	possibly damaging	Het
Crnn	T	C	3: 93,148,135	V76A	probably damaging	Het
Cspg4	A	G	9: 56,887,101	T707A	probably benign	Het
Dgkh	A	T	14: 78,627,742	C53*	probably null	Het
Dhx34	G	T	7: 16,215,330	A391E	possibly damaging	Het
Dlx1	C	A	2: 71,532,353	N201K	probably benign	Het
Dnah6	T	C	6: 73,021,178	E4087G	probably benign	Het
Dock6	T	C	9: 21,845,550	Y134C	probably damaging	Het
Duox2	A	G	2: 122,291,227	V662A	possibly damaging	Het
Dusp12	A	G	1: 170,880,961	F12L	probably damaging	Het
Eppk1	T	C	15: 76,111,037	E548G	probably benign	Het
Foxj2	A	G	6: 122,828,444	I92V	probably damaging	Het
Foxj2	A	G	6: 122,842,839	D562G	probably benign	Het
Gm17728	A	G	17: 9,422,159	R34G	probably damaging	Het
Gpc6	T	C	14: 117,624,548	I292T	probably damaging	Het
Gpr15	T	A	16: 58,718,185	K180N	probably benign	Het
Gtf2ird1	G	T	5: 134,383,922		probably benign	Het
Hist1h2ah	A	G	13: 22,035,549	S2P	probably benign	Het
Hps3	T	A	3: 20,022,820	T393S	probably damaging	Het
Hspa1a	A	T	17: 34,970,291		probably null	Het
Hydin	A	G	8: 110,531,072	E2378G	possibly damaging	Het
Ighv1-18	A	G	12: 114,682,678	L102P	probably damaging	Het
Itga5	T	A	15: 103,350,226	N814I	probably benign	Het
Kcnb2	T	C	1: 15,710,256	S451P	probably damaging	Het
Klhl32	T	G	4: 24,709,030	I112L	probably damaging	Het
Knstrn	T	G	2: 118,834,094	I47R	possibly damaging	Het
Med23	T	A	10: 24,895,824	S581T	possibly damaging	Het
Nipal3	A	G	4: 135,479,547	V112A	probably damaging	Het
Olfr1287	T	C	2: 111,449,352	F71L	probably benign	Het
Olfr1359	A	G	13: 21,703,073	E24G	probably benign	Het
Olfr713	T	A	7: 107,036,749	V198D	possibly damaging	Het
Olfr996	A	G	2: 85,579,481	M81V	probably benign	Het
Paxip1	G	A	5: 27,765,768	Q528*	probably null	Het
Proser2	T	C	2: 6,113,990	D14G	probably damaging	Het
Rp1	T	G	1: 4,345,655	I1745L	probably benign	Het
Rxfp2	G	T	5: 150,048,848		probably null	Het
Slc45a1	T	C	4: 150,638,594	S278G	possibly damaging	Het
Smurf1	A	G	5: 144,886,369	I455T	possibly damaging	Het
Speg	T	C	1: 75,430,913	L3188P	probably damaging	Het
Tcaf3	G	T	6: 42,597,125	A51D	probably damaging	Het
Tecrl	T	C	5: 83,354,921	N12S	possibly damaging	Het
Tmem17	T	A	11: 22,518,508	I149N	possibly damaging	Het
Tmem171	A	G	13: 98,692,468	V58A	possibly damaging	Het
Ttn	A	G	2: 76,861,177		probably benign	Het
Ubqln5	A	G	7: 104,128,601	S339P	probably benign	Het
Vmn1r16	T	A	6: 57,323,488	I50L	probably benign	Het
Vmn2r103	A	T	17: 19,793,477	Y177F	probably benign	Het
Zfp28	C	A	7: 6,394,693	T709K	probably damaging	Het
Zfp958	A	G	8: 4,626,170	N46S	probably benign	Het
Zyx	T	A	6: 42,350,357	V30E	unknown	Het

Other mutations in Mgat5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Mgat5	APN	1	127387467	missense	probably damaging	1.00
IGL00813:Mgat5	APN	1	127384806	missense	probably benign
IGL01795:Mgat5	APN	1	127469231	missense	probably damaging	0.98
IGL01830:Mgat5	APN	1	127412132	missense	probably damaging	1.00
IGL01879:Mgat5	APN	1	127397550	missense	probably damaging	0.99
IGL02322:Mgat5	APN	1	127382985	missense	probably benign	0.00
IGL02621:Mgat5	APN	1	127397589	missense	possibly damaging	0.86
IGL02695:Mgat5	APN	1	127412131	missense	probably damaging	1.00
IGL03142:Mgat5	APN	1	127412223	missense	probably damaging	1.00
Cowlick	UTSW	1	127471564	missense	probably benign	0.36
Curls	UTSW	1	127320634	missense	possibly damaging	0.77
R0518:Mgat5	UTSW	1	127384847	missense	probably damaging	1.00
R0594:Mgat5	UTSW	1	127412248	missense	probably damaging	0.96
R1480:Mgat5	UTSW	1	127459979	missense	probably damaging	1.00
R1501:Mgat5	UTSW	1	127397641	critical splice donor site	probably null
R1712:Mgat5	UTSW	1	127320638	missense	probably benign	0.34
R1744:Mgat5	UTSW	1	127479469	missense	probably damaging	1.00
R1862:Mgat5	UTSW	1	127459969	missense	probably damaging	1.00
R1994:Mgat5	UTSW	1	127459959	missense	possibly damaging	0.82
R2054:Mgat5	UTSW	1	127397607	missense	probably damaging	1.00
R2150:Mgat5	UTSW	1	127469250	missense	probably damaging	1.00
R2303:Mgat5	UTSW	1	127446299	missense	probably benign	0.00
R2566:Mgat5	UTSW	1	127307004	missense	probably benign	0.01
R3498:Mgat5	UTSW	1	127384834	missense	possibly damaging	0.55
R3788:Mgat5	UTSW	1	127366443	missense	probably benign
R4674:Mgat5	UTSW	1	127390758	missense	probably damaging	1.00
R4873:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R4875:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R5175:Mgat5	UTSW	1	127459912	missense	probably damaging	0.97
R5310:Mgat5	UTSW	1	127387514	critical splice donor site	probably null
R5337:Mgat5	UTSW	1	127459921	missense	possibly damaging	0.84
R5597:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5599:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5861:Mgat5	UTSW	1	127387392	missense	probably damaging	1.00
R5956:Mgat5	UTSW	1	127382939	missense	probably benign	0.10
R6042:Mgat5	UTSW	1	127459899	missense	probably damaging	1.00
R6223:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.86
R6492:Mgat5	UTSW	1	127471564	missense	probably benign	0.36
R6662:Mgat5	UTSW	1	127469237	missense	probably damaging	1.00
R6960:Mgat5	UTSW	1	127320634	missense	possibly damaging	0.77
R7110:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.92
R7133:Mgat5	UTSW	1	127365189	missense	probably benign
R7142:Mgat5	UTSW	1	127412187	missense	probably damaging	1.00
R7151:Mgat5	UTSW	1	127446262	missense	probably damaging	0.97
R7506:Mgat5	UTSW	1	127366455	missense	probably benign	0.24
R7790:Mgat5	UTSW	1	127412204	missense	probably benign	0.23
R7980:Mgat5	UTSW	1	127479511	missense	probably benign	0.13
R8548:Mgat5	UTSW	1	127320672	missense	possibly damaging	0.77
R9008:Mgat5	UTSW	1	127479571	missense	probably damaging	1.00
R9127:Mgat5	UTSW	1	127366460	missense	probably benign	0.14
R9279:Mgat5	UTSW	1	127397611	missense	probably damaging	1.00
R9599:Mgat5	UTSW	1	127320708	missense	probably benign	0.02
X0028:Mgat5	UTSW	1	127366485	missense	possibly damaging	0.91
Z1177:Mgat5	UTSW	1	127482692	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAACCTATCAAAGTTGCCAGG -3'
(R):5'- ACCCTAGGAAGCATACAGTCAG -3'

Sequencing Primer
(F):5'- CAAAGTTGCCAGGTTTAGTACTG -3'
(R):5'- TCAGGGGGAATAGCCTGAATTTC -3'

Posted On

2018-11-28