Incidental Mutation 'R6981:Smurf1'
ID542668
Institutional Source Beutler Lab
Gene Symbol Smurf1
Ensembl Gene ENSMUSG00000038780
Gene NameSMAD specific E3 ubiquitin protein ligase 1
Synonyms4930431E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6981 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location144876495-144965847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144886369 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 455 (I455T)
Ref Sequence ENSEMBL: ENSMUSP00000098029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085684] [ENSMUST00000100461] [ENSMUST00000110677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085684
AA Change: I455T

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082827
Gene: ENSMUSG00000038780
AA Change: I455T

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 731 3.48e-160 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100461
AA Change: I455T

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098029
Gene: ENSMUSG00000038780
AA Change: I455T

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 728 2.72e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110677
AA Change: I481T

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106305
Gene: ENSMUSG00000038780
AA Change: I481T

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 307 339 8.66e-13 SMART
HECTc 418 757 3.48e-160 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin ligase that is specific for receptor-regulated SMAD proteins in the bone morphogenetic protein (BMP) pathway. This protein plays a key roll in the regulation of cell motility, cell signalling, and cell polarity. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for one knock-out allele display increased osteoblast function, bone density, and thickness of the cortical bone in long bones. Mice homozygous for a different knock-out allele are viable and only display gastrulation defects in combination with a Smurf2 knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,293,718 probably benign Het
5031439G07Rik A C 15: 84,949,597 Y419* probably null Het
Abca2 T A 2: 25,444,139 F1809L probably damaging Het
Ache C T 5: 137,291,678 T423I probably benign Het
Acvrl1 A G 15: 101,138,345 T395A probably damaging Het
Ap3b2 A G 7: 81,477,993 I145T probably damaging Het
Arhgef4 A C 1: 34,722,452 Q263P unknown Het
Asgr2 C T 11: 70,096,810 L45F probably damaging Het
Baiap2l1 T A 5: 144,285,579 Y122F possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Car8 A T 4: 8,185,650 probably null Het
Carns1 T C 19: 4,170,082 T385A probably benign Het
Ccdc47 T C 11: 106,202,737 T41A probably benign Het
Ccne1 A T 7: 38,098,573 probably benign Het
Cdh4 C T 2: 179,797,504 T148I probably benign Het
Cep85 C T 4: 134,152,261 R392Q probably damaging Het
Ces1h T C 8: 93,353,495 T464A unknown Het
Cfl1 T A 19: 5,492,616 S41R possibly damaging Het
Crnn T C 3: 93,148,135 V76A probably damaging Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Dgkh A T 14: 78,627,742 C53* probably null Het
Dhx34 G T 7: 16,215,330 A391E possibly damaging Het
Dlx1 C A 2: 71,532,353 N201K probably benign Het
Dnah6 T C 6: 73,021,178 E4087G probably benign Het
Dock6 T C 9: 21,845,550 Y134C probably damaging Het
Duox2 A G 2: 122,291,227 V662A possibly damaging Het
Dusp12 A G 1: 170,880,961 F12L probably damaging Het
Eppk1 T C 15: 76,111,037 E548G probably benign Het
Foxj2 A G 6: 122,828,444 I92V probably damaging Het
Foxj2 A G 6: 122,842,839 D562G probably benign Het
Gm17728 A G 17: 9,422,159 R34G probably damaging Het
Gpc6 T C 14: 117,624,548 I292T probably damaging Het
Gpr15 T A 16: 58,718,185 K180N probably benign Het
Gtf2ird1 G T 5: 134,383,922 probably benign Het
Hist1h2ah A G 13: 22,035,549 S2P probably benign Het
Hps3 T A 3: 20,022,820 T393S probably damaging Het
Hspa1a A T 17: 34,970,291 probably null Het
Hydin A G 8: 110,531,072 E2378G possibly damaging Het
Ighv1-18 A G 12: 114,682,678 L102P probably damaging Het
Itga5 T A 15: 103,350,226 N814I probably benign Het
Kcnb2 T C 1: 15,710,256 S451P probably damaging Het
Klhl32 T G 4: 24,709,030 I112L probably damaging Het
Knstrn T G 2: 118,834,094 I47R possibly damaging Het
Med23 T A 10: 24,895,824 S581T possibly damaging Het
Mgat5 C T 1: 127,390,851 T361I probably damaging Het
Nipal3 A G 4: 135,479,547 V112A probably damaging Het
Olfr1287 T C 2: 111,449,352 F71L probably benign Het
Olfr1359 A G 13: 21,703,073 E24G probably benign Het
Olfr713 T A 7: 107,036,749 V198D possibly damaging Het
Olfr996 A G 2: 85,579,481 M81V probably benign Het
Paxip1 G A 5: 27,765,768 Q528* probably null Het
Proser2 T C 2: 6,113,990 D14G probably damaging Het
Rp1 T G 1: 4,345,655 I1745L probably benign Het
Rxfp2 G T 5: 150,048,848 probably null Het
Slc45a1 T C 4: 150,638,594 S278G possibly damaging Het
Speg T C 1: 75,430,913 L3188P probably damaging Het
Tcaf3 G T 6: 42,597,125 A51D probably damaging Het
Tecrl T C 5: 83,354,921 N12S possibly damaging Het
Tmem17 T A 11: 22,518,508 I149N possibly damaging Het
Tmem171 A G 13: 98,692,468 V58A possibly damaging Het
Ttn A G 2: 76,861,177 probably benign Het
Ubqln5 A G 7: 104,128,601 S339P probably benign Het
Vmn1r16 T A 6: 57,323,488 I50L probably benign Het
Vmn2r103 A T 17: 19,793,477 Y177F probably benign Het
Zfp28 C A 7: 6,394,693 T709K probably damaging Het
Zfp958 A G 8: 4,626,170 N46S probably benign Het
Zyx T A 6: 42,350,357 V30E unknown Het
Other mutations in Smurf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Smurf1 APN 5 144881774 missense probably benign 0.00
IGL01577:Smurf1 APN 5 144893188 missense probably damaging 0.99
IGL02232:Smurf1 APN 5 144886438 missense probably damaging 1.00
IGL02407:Smurf1 APN 5 144884724 missense probably damaging 1.00
IGL02959:Smurf1 APN 5 144899389 missense probably damaging 1.00
IGL02997:Smurf1 APN 5 144898005 nonsense probably null
IGL03227:Smurf1 APN 5 144899182 missense probably damaging 1.00
IGL03293:Smurf1 APN 5 144881799 missense probably benign
R1563:Smurf1 UTSW 5 144882513 missense probably damaging 1.00
R1652:Smurf1 UTSW 5 144880664 missense probably damaging 1.00
R2698:Smurf1 UTSW 5 144883562 unclassified probably benign
R3794:Smurf1 UTSW 5 144901175 critical splice donor site probably null
R4274:Smurf1 UTSW 5 144896775 intron probably benign
R4282:Smurf1 UTSW 5 144882593 missense probably damaging 1.00
R4287:Smurf1 UTSW 5 144891458 missense probably benign 0.00
R4643:Smurf1 UTSW 5 144879369 missense probably damaging 1.00
R4723:Smurf1 UTSW 5 144893184 missense probably damaging 1.00
R5496:Smurf1 UTSW 5 144882593 nonsense probably null
R5702:Smurf1 UTSW 5 144901211 missense possibly damaging 0.96
R5846:Smurf1 UTSW 5 144879380 missense probably damaging 1.00
R6107:Smurf1 UTSW 5 144894504 missense possibly damaging 0.75
R6263:Smurf1 UTSW 5 144881731 missense probably damaging 0.96
R6477:Smurf1 UTSW 5 144889792 missense possibly damaging 0.49
R6548:Smurf1 UTSW 5 144899497 missense probably damaging 1.00
R6584:Smurf1 UTSW 5 144882523 missense probably damaging 0.97
R7062:Smurf1 UTSW 5 144893546 intron probably null
R7900:Smurf1 UTSW 5 144899373 missense probably damaging 1.00
R7983:Smurf1 UTSW 5 144899373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCAGGCACAGAGCAGC -3'
(R):5'- CTTGAGATGTTCATCTACCAAACTC -3'

Sequencing Primer
(F):5'- GAGCAGCCCAGATCCACAG -3'
(R):5'- GCCTAGTCTACAGAGGGAATTCC -3'
Posted On2018-11-28