Incidental Mutation 'R6981:Tcaf3'
ID 542670
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 045089-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R6981 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 42574059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 51 (A51D)
Ref Sequence ENSEMBL: ENSMUSP00000123321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably damaging
Transcript: ENSMUST00000069023
AA Change: A51D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: A51D

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134707
AA Change: A51D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: A51D

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,184,544 (GRCm39) probably benign Het
5031439G07Rik A C 15: 84,833,798 (GRCm39) Y419* probably null Het
Abca2 T A 2: 25,334,151 (GRCm39) F1809L probably damaging Het
Ache C T 5: 137,289,940 (GRCm39) T423I probably benign Het
Acvrl1 A G 15: 101,036,226 (GRCm39) T395A probably damaging Het
Ap3b2 A G 7: 81,127,741 (GRCm39) I145T probably damaging Het
Arhgef4 A C 1: 34,761,533 (GRCm39) Q263P unknown Het
Asgr2 C T 11: 69,987,636 (GRCm39) L45F probably damaging Het
Baiap2l1 T A 5: 144,222,389 (GRCm39) Y122F possibly damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Car8 A T 4: 8,185,650 (GRCm39) probably null Het
Carns1 T C 19: 4,220,081 (GRCm39) T385A probably benign Het
Ccdc47 T C 11: 106,093,563 (GRCm39) T41A probably benign Het
Ccne1 A T 7: 37,797,998 (GRCm39) probably benign Het
Cdh4 C T 2: 179,439,297 (GRCm39) T148I probably benign Het
Cep85 C T 4: 133,879,572 (GRCm39) R392Q probably damaging Het
Ces1h T C 8: 94,080,123 (GRCm39) T464A unknown Het
Cfl1 T A 19: 5,542,644 (GRCm39) S41R possibly damaging Het
Crnn T C 3: 93,055,442 (GRCm39) V76A probably damaging Het
Cspg4 A G 9: 56,794,385 (GRCm39) T707A probably benign Het
Dgkh A T 14: 78,865,182 (GRCm39) C53* probably null Het
Dhx34 G T 7: 15,949,255 (GRCm39) A391E possibly damaging Het
Dlx1 C A 2: 71,362,697 (GRCm39) N201K probably benign Het
Dnah6 T C 6: 72,998,161 (GRCm39) E4087G probably benign Het
Dock6 T C 9: 21,756,846 (GRCm39) Y134C probably damaging Het
Duox2 A G 2: 122,121,708 (GRCm39) V662A possibly damaging Het
Dusp12 A G 1: 170,708,530 (GRCm39) F12L probably damaging Het
Eppk1 T C 15: 75,995,237 (GRCm39) E548G probably benign Het
Foxj2 A G 6: 122,819,798 (GRCm39) D562G probably benign Het
Foxj2 A G 6: 122,805,403 (GRCm39) I92V probably damaging Het
Gm17728 A G 17: 9,640,991 (GRCm39) R34G probably damaging Het
Gpc6 T C 14: 117,861,960 (GRCm39) I292T probably damaging Het
Gpr15 T A 16: 58,538,548 (GRCm39) K180N probably benign Het
Gtf2ird1 G T 5: 134,412,776 (GRCm39) probably benign Het
H2ac12 A G 13: 22,219,719 (GRCm39) S2P probably benign Het
Hps3 T A 3: 20,076,984 (GRCm39) T393S probably damaging Het
Hspa1a A T 17: 35,189,267 (GRCm39) probably null Het
Hydin A G 8: 111,257,704 (GRCm39) E2378G possibly damaging Het
Ighv1-18 A G 12: 114,646,298 (GRCm39) L102P probably damaging Het
Itga5 T A 15: 103,258,653 (GRCm39) N814I probably benign Het
Kcnb2 T C 1: 15,780,480 (GRCm39) S451P probably damaging Het
Klhl32 T G 4: 24,709,030 (GRCm39) I112L probably damaging Het
Knstrn T G 2: 118,664,575 (GRCm39) I47R possibly damaging Het
Med23 T A 10: 24,771,722 (GRCm39) S581T possibly damaging Het
Mgat5 C T 1: 127,318,588 (GRCm39) T361I probably damaging Het
Nipal3 A G 4: 135,206,858 (GRCm39) V112A probably damaging Het
Or10a5 T A 7: 106,635,956 (GRCm39) V198D possibly damaging Het
Or2b2 A G 13: 21,887,243 (GRCm39) E24G probably benign Het
Or4k41 T C 2: 111,279,697 (GRCm39) F71L probably benign Het
Or5g27 A G 2: 85,409,825 (GRCm39) M81V probably benign Het
Paxip1 G A 5: 27,970,766 (GRCm39) Q528* probably null Het
Proser2 T C 2: 6,118,801 (GRCm39) D14G probably damaging Het
Rp1 T G 1: 4,415,878 (GRCm39) I1745L probably benign Het
Rxfp2 G T 5: 149,972,313 (GRCm39) probably null Het
Slc45a1 T C 4: 150,723,051 (GRCm39) S278G possibly damaging Het
Smurf1 A G 5: 144,823,179 (GRCm39) I455T possibly damaging Het
Speg T C 1: 75,407,557 (GRCm39) L3188P probably damaging Het
Tecrl T C 5: 83,502,768 (GRCm39) N12S possibly damaging Het
Tmem17 T A 11: 22,468,508 (GRCm39) I149N possibly damaging Het
Tmem171 A G 13: 98,828,976 (GRCm39) V58A possibly damaging Het
Ttn A G 2: 76,691,521 (GRCm39) probably benign Het
Ubqln5 A G 7: 103,777,808 (GRCm39) S339P probably benign Het
Vmn1r16 T A 6: 57,300,473 (GRCm39) I50L probably benign Het
Vmn2r103 A T 17: 20,013,739 (GRCm39) Y177F probably benign Het
Zfp28 C A 7: 6,397,692 (GRCm39) T709K probably damaging Het
Zfp958 A G 8: 4,676,170 (GRCm39) N46S probably benign Het
Zyx T A 6: 42,327,291 (GRCm39) V30E unknown Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGAACCAAGGCATTTATCC -3'
(R):5'- AGGATTCGTCGTGTAAGACTCTG -3'

Sequencing Primer
(F):5'- GGCATTTATCCCAGAATCACCTAGG -3'
(R):5'- CGTCGTGTAAGACTCTGTGAAAACAC -3'
Posted On 2018-11-28