Incidental Mutation 'R6981:Foxj2'
ID542674
Institutional Source Beutler Lab
Gene Symbol Foxj2
Ensembl Gene ENSMUSG00000003154
Gene Nameforkhead box J2
SynonymsFhx
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.427) question?
Stock #R6981 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location122819914-122845366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122842839 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 562 (D562G)
Ref Sequence ENSEMBL: ENSMUSP00000137645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003238] [ENSMUST00000042081] [ENSMUST00000177927]
Predicted Effect probably benign
Transcript: ENSMUST00000003238
AA Change: D562G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003238
Gene: ENSMUSG00000003154
AA Change: D562G

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042081
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177927
AA Change: D562G

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137645
Gene: ENSMUSG00000003154
AA Change: D562G

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,293,718 probably benign Het
5031439G07Rik A C 15: 84,949,597 Y419* probably null Het
Abca2 T A 2: 25,444,139 F1809L probably damaging Het
Ache C T 5: 137,291,678 T423I probably benign Het
Acvrl1 A G 15: 101,138,345 T395A probably damaging Het
Ap3b2 A G 7: 81,477,993 I145T probably damaging Het
Arhgef4 A C 1: 34,722,452 Q263P unknown Het
Asgr2 C T 11: 70,096,810 L45F probably damaging Het
Baiap2l1 T A 5: 144,285,579 Y122F possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Car8 A T 4: 8,185,650 probably null Het
Carns1 T C 19: 4,170,082 T385A probably benign Het
Ccdc47 T C 11: 106,202,737 T41A probably benign Het
Ccne1 A T 7: 38,098,573 probably benign Het
Cdh4 C T 2: 179,797,504 T148I probably benign Het
Cep85 C T 4: 134,152,261 R392Q probably damaging Het
Ces1h T C 8: 93,353,495 T464A unknown Het
Cfl1 T A 19: 5,492,616 S41R possibly damaging Het
Crnn T C 3: 93,148,135 V76A probably damaging Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Dgkh A T 14: 78,627,742 C53* probably null Het
Dhx34 G T 7: 16,215,330 A391E possibly damaging Het
Dlx1 C A 2: 71,532,353 N201K probably benign Het
Dnah6 T C 6: 73,021,178 E4087G probably benign Het
Dock6 T C 9: 21,845,550 Y134C probably damaging Het
Duox2 A G 2: 122,291,227 V662A possibly damaging Het
Dusp12 A G 1: 170,880,961 F12L probably damaging Het
Eppk1 T C 15: 76,111,037 E548G probably benign Het
Gm17728 A G 17: 9,422,159 R34G probably damaging Het
Gpc6 T C 14: 117,624,548 I292T probably damaging Het
Gpr15 T A 16: 58,718,185 K180N probably benign Het
Gtf2ird1 G T 5: 134,383,922 probably benign Het
Hist1h2ah A G 13: 22,035,549 S2P probably benign Het
Hps3 T A 3: 20,022,820 T393S probably damaging Het
Hspa1a A T 17: 34,970,291 probably null Het
Hydin A G 8: 110,531,072 E2378G possibly damaging Het
Ighv1-18 A G 12: 114,682,678 L102P probably damaging Het
Itga5 T A 15: 103,350,226 N814I probably benign Het
Kcnb2 T C 1: 15,710,256 S451P probably damaging Het
Klhl32 T G 4: 24,709,030 I112L probably damaging Het
Knstrn T G 2: 118,834,094 I47R possibly damaging Het
Med23 T A 10: 24,895,824 S581T possibly damaging Het
Mgat5 C T 1: 127,390,851 T361I probably damaging Het
Nipal3 A G 4: 135,479,547 V112A probably damaging Het
Olfr1287 T C 2: 111,449,352 F71L probably benign Het
Olfr1359 A G 13: 21,703,073 E24G probably benign Het
Olfr713 T A 7: 107,036,749 V198D possibly damaging Het
Olfr996 A G 2: 85,579,481 M81V probably benign Het
Paxip1 G A 5: 27,765,768 Q528* probably null Het
Proser2 T C 2: 6,113,990 D14G probably damaging Het
Rp1 T G 1: 4,345,655 I1745L probably benign Het
Rxfp2 G T 5: 150,048,848 probably null Het
Slc45a1 T C 4: 150,638,594 S278G possibly damaging Het
Smurf1 A G 5: 144,886,369 I455T possibly damaging Het
Speg T C 1: 75,430,913 L3188P probably damaging Het
Tcaf3 G T 6: 42,597,125 A51D probably damaging Het
Tecrl T C 5: 83,354,921 N12S possibly damaging Het
Tmem17 T A 11: 22,518,508 I149N possibly damaging Het
Tmem171 A G 13: 98,692,468 V58A possibly damaging Het
Ttn A G 2: 76,861,177 probably benign Het
Ubqln5 A G 7: 104,128,601 S339P probably benign Het
Vmn1r16 T A 6: 57,323,488 I50L probably benign Het
Vmn2r103 A T 17: 19,793,477 Y177F probably benign Het
Zfp28 C A 7: 6,394,693 T709K probably damaging Het
Zfp958 A G 8: 4,626,170 N46S probably benign Het
Zyx T A 6: 42,350,357 V30E unknown Het
Other mutations in Foxj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Foxj2 APN 6 122839635 missense probably damaging 1.00
IGL01100:Foxj2 APN 6 122828391 missense probably damaging 1.00
IGL02169:Foxj2 APN 6 122828466 missense probably damaging 0.98
IGL02220:Foxj2 APN 6 122838581 splice site probably benign
IGL02423:Foxj2 APN 6 122842773 missense possibly damaging 0.90
IGL03026:Foxj2 APN 6 122838180 missense probably benign 0.38
IGL03198:Foxj2 APN 6 122833007 critical splice donor site probably null
R0400:Foxj2 UTSW 6 122833808 missense possibly damaging 0.69
R1572:Foxj2 UTSW 6 122833261 missense probably benign 0.00
R2063:Foxj2 UTSW 6 122840241 missense probably benign 0.01
R2568:Foxj2 UTSW 6 122828372 missense probably damaging 1.00
R2877:Foxj2 UTSW 6 122842832 missense probably damaging 0.96
R4745:Foxj2 UTSW 6 122837989 missense probably damaging 1.00
R4763:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4764:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4765:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4775:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R5056:Foxj2 UTSW 6 122833874 missense probably benign 0.00
R5816:Foxj2 UTSW 6 122833736 missense probably benign
R6254:Foxj2 UTSW 6 122838139 missense probably damaging 0.98
R6265:Foxj2 UTSW 6 122828174 missense probably damaging 0.99
R6540:Foxj2 UTSW 6 122833243 missense probably benign
R6882:Foxj2 UTSW 6 122828505 critical splice donor site probably null
R6981:Foxj2 UTSW 6 122828444 missense probably damaging 1.00
R7295:Foxj2 UTSW 6 122840231 missense probably benign 0.14
R7475:Foxj2 UTSW 6 122837842 missense probably benign 0.14
Z1176:Foxj2 UTSW 6 122832936 critical splice acceptor site probably null
Z1176:Foxj2 UTSW 6 122833711 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTGACTGACTAGACTGTAG -3'
(R):5'- ATTATCCTCGGCAGCATCTTG -3'

Sequencing Primer
(F):5'- ACTAGACTGTAGGCTGACTGTACC -3'
(R):5'- CATCTTGCGGTGGCGTCTC -3'
Posted On2018-11-28