Incidental Mutation 'R6981:Ap3b2'
ID542679
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6981 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81477993 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 145 (I145T)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
Predicted Effect probably damaging
Transcript: ENSMUST00000082090
AA Change: I145T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: I145T

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000152355
AA Change: I145T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,293,718 probably benign Het
5031439G07Rik A C 15: 84,949,597 Y419* probably null Het
Abca2 T A 2: 25,444,139 F1809L probably damaging Het
Ache C T 5: 137,291,678 T423I probably benign Het
Acvrl1 A G 15: 101,138,345 T395A probably damaging Het
Arhgef4 A C 1: 34,722,452 Q263P unknown Het
Asgr2 C T 11: 70,096,810 L45F probably damaging Het
Baiap2l1 T A 5: 144,285,579 Y122F possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Car8 A T 4: 8,185,650 probably null Het
Carns1 T C 19: 4,170,082 T385A probably benign Het
Ccdc47 T C 11: 106,202,737 T41A probably benign Het
Ccne1 A T 7: 38,098,573 probably benign Het
Cdh4 C T 2: 179,797,504 T148I probably benign Het
Cep85 C T 4: 134,152,261 R392Q probably damaging Het
Ces1h T C 8: 93,353,495 T464A unknown Het
Cfl1 T A 19: 5,492,616 S41R possibly damaging Het
Crnn T C 3: 93,148,135 V76A probably damaging Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Dgkh A T 14: 78,627,742 C53* probably null Het
Dhx34 G T 7: 16,215,330 A391E possibly damaging Het
Dlx1 C A 2: 71,532,353 N201K probably benign Het
Dnah6 T C 6: 73,021,178 E4087G probably benign Het
Dock6 T C 9: 21,845,550 Y134C probably damaging Het
Duox2 A G 2: 122,291,227 V662A possibly damaging Het
Dusp12 A G 1: 170,880,961 F12L probably damaging Het
Eppk1 T C 15: 76,111,037 E548G probably benign Het
Foxj2 A G 6: 122,828,444 I92V probably damaging Het
Foxj2 A G 6: 122,842,839 D562G probably benign Het
Gm17728 A G 17: 9,422,159 R34G probably damaging Het
Gpc6 T C 14: 117,624,548 I292T probably damaging Het
Gpr15 T A 16: 58,718,185 K180N probably benign Het
Gtf2ird1 G T 5: 134,383,922 probably benign Het
Hist1h2ah A G 13: 22,035,549 S2P probably benign Het
Hps3 T A 3: 20,022,820 T393S probably damaging Het
Hspa1a A T 17: 34,970,291 probably null Het
Hydin A G 8: 110,531,072 E2378G possibly damaging Het
Ighv1-18 A G 12: 114,682,678 L102P probably damaging Het
Itga5 T A 15: 103,350,226 N814I probably benign Het
Kcnb2 T C 1: 15,710,256 S451P probably damaging Het
Klhl32 T G 4: 24,709,030 I112L probably damaging Het
Knstrn T G 2: 118,834,094 I47R possibly damaging Het
Med23 T A 10: 24,895,824 S581T possibly damaging Het
Mgat5 C T 1: 127,390,851 T361I probably damaging Het
Nipal3 A G 4: 135,479,547 V112A probably damaging Het
Olfr1287 T C 2: 111,449,352 F71L probably benign Het
Olfr1359 A G 13: 21,703,073 E24G probably benign Het
Olfr713 T A 7: 107,036,749 V198D possibly damaging Het
Olfr996 A G 2: 85,579,481 M81V probably benign Het
Paxip1 G A 5: 27,765,768 Q528* probably null Het
Proser2 T C 2: 6,113,990 D14G probably damaging Het
Rp1 T G 1: 4,345,655 I1745L probably benign Het
Rxfp2 G T 5: 150,048,848 probably null Het
Slc45a1 T C 4: 150,638,594 S278G possibly damaging Het
Smurf1 A G 5: 144,886,369 I455T possibly damaging Het
Speg T C 1: 75,430,913 L3188P probably damaging Het
Tcaf3 G T 6: 42,597,125 A51D probably damaging Het
Tecrl T C 5: 83,354,921 N12S possibly damaging Het
Tmem17 T A 11: 22,518,508 I149N possibly damaging Het
Tmem171 A G 13: 98,692,468 V58A possibly damaging Het
Ttn A G 2: 76,861,177 probably benign Het
Ubqln5 A G 7: 104,128,601 S339P probably benign Het
Vmn1r16 T A 6: 57,323,488 I50L probably benign Het
Vmn2r103 A T 17: 19,793,477 Y177F probably benign Het
Zfp28 C A 7: 6,394,693 T709K probably damaging Het
Zfp958 A G 8: 4,626,170 N46S probably benign Het
Zyx T A 6: 42,350,357 V30E unknown Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTATTCCAGACGAGAAGCAGC -3'
(R):5'- AAGCTAGCCCTTGTCAGGAG -3'

Sequencing Primer
(F):5'- CCTGCAAAACCGTGGTAAGGTC -3'
(R):5'- CTAGCCCTTGTCAGGAGGTAGG -3'
Posted On2018-11-28