Incidental Mutation 'R6981:Cspg4'
ID 542686
Institutional Source Beutler Lab
Gene Symbol Cspg4
Ensembl Gene ENSMUSG00000032911
Gene Name chondroitin sulfate proteoglycan 4
Synonyms AN2, 4732461B14Rik, NG2
MMRRC Submission 045089-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6981 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 56865033-56899870 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 56887101 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 707 (T707A)
Ref Sequence ENSEMBL: ENSMUSP00000038909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035661]
AlphaFold Q8VHY0
Predicted Effect probably benign
Transcript: ENSMUST00000035661
AA Change: T707A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: T707A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
LamG 47 179 9.16e-22 SMART
LamG 223 364 3.52e-23 SMART
low complexity region 384 397 N/A INTRINSIC
Pfam:Cadherin_3 495 646 1e-36 PFAM
Pfam:Cadherin_3 732 885 7.9e-14 PFAM
Pfam:Cadherin_3 868 996 7e-15 PFAM
Pfam:Cadherin_3 972 1115 9e-26 PFAM
Pfam:Cadherin_3 1116 1223 1.1e-10 PFAM
Pfam:Cadherin_3 1225 1344 3.3e-12 PFAM
Pfam:Cadherin_3 1425 1568 6.3e-52 PFAM
Pfam:Cadherin_3 1578 1684 9.7e-9 PFAM
Pfam:Cadherin_3 1674 1809 3.2e-9 PFAM
Pfam:Cadherin_3 1779 1929 1.6e-31 PFAM
transmembrane domain 2229 2251 N/A INTRINSIC
low complexity region 2295 2305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215666
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,293,718 probably benign Het
5031439G07Rik A C 15: 84,949,597 Y419* probably null Het
Abca2 T A 2: 25,444,139 F1809L probably damaging Het
Ache C T 5: 137,291,678 T423I probably benign Het
Acvrl1 A G 15: 101,138,345 T395A probably damaging Het
Ap3b2 A G 7: 81,477,993 I145T probably damaging Het
Arhgef4 A C 1: 34,722,452 Q263P unknown Het
Asgr2 C T 11: 70,096,810 L45F probably damaging Het
Baiap2l1 T A 5: 144,285,579 Y122F possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Car8 A T 4: 8,185,650 probably null Het
Carns1 T C 19: 4,170,082 T385A probably benign Het
Ccdc47 T C 11: 106,202,737 T41A probably benign Het
Ccne1 A T 7: 38,098,573 probably benign Het
Cdh4 C T 2: 179,797,504 T148I probably benign Het
Cep85 C T 4: 134,152,261 R392Q probably damaging Het
Ces1h T C 8: 93,353,495 T464A unknown Het
Cfl1 T A 19: 5,492,616 S41R possibly damaging Het
Crnn T C 3: 93,148,135 V76A probably damaging Het
Dgkh A T 14: 78,627,742 C53* probably null Het
Dhx34 G T 7: 16,215,330 A391E possibly damaging Het
Dlx1 C A 2: 71,532,353 N201K probably benign Het
Dnah6 T C 6: 73,021,178 E4087G probably benign Het
Dock6 T C 9: 21,845,550 Y134C probably damaging Het
Duox2 A G 2: 122,291,227 V662A possibly damaging Het
Dusp12 A G 1: 170,880,961 F12L probably damaging Het
Eppk1 T C 15: 76,111,037 E548G probably benign Het
Foxj2 A G 6: 122,828,444 I92V probably damaging Het
Foxj2 A G 6: 122,842,839 D562G probably benign Het
Gm17728 A G 17: 9,422,159 R34G probably damaging Het
Gpc6 T C 14: 117,624,548 I292T probably damaging Het
Gpr15 T A 16: 58,718,185 K180N probably benign Het
Gtf2ird1 G T 5: 134,383,922 probably benign Het
Hist1h2ah A G 13: 22,035,549 S2P probably benign Het
Hps3 T A 3: 20,022,820 T393S probably damaging Het
Hspa1a A T 17: 34,970,291 probably null Het
Hydin A G 8: 110,531,072 E2378G possibly damaging Het
Ighv1-18 A G 12: 114,682,678 L102P probably damaging Het
Itga5 T A 15: 103,350,226 N814I probably benign Het
Kcnb2 T C 1: 15,710,256 S451P probably damaging Het
Klhl32 T G 4: 24,709,030 I112L probably damaging Het
Knstrn T G 2: 118,834,094 I47R possibly damaging Het
Med23 T A 10: 24,895,824 S581T possibly damaging Het
Mgat5 C T 1: 127,390,851 T361I probably damaging Het
Nipal3 A G 4: 135,479,547 V112A probably damaging Het
Olfr1287 T C 2: 111,449,352 F71L probably benign Het
Olfr1359 A G 13: 21,703,073 E24G probably benign Het
Olfr713 T A 7: 107,036,749 V198D possibly damaging Het
Olfr996 A G 2: 85,579,481 M81V probably benign Het
Paxip1 G A 5: 27,765,768 Q528* probably null Het
Proser2 T C 2: 6,113,990 D14G probably damaging Het
Rp1 T G 1: 4,345,655 I1745L probably benign Het
Rxfp2 G T 5: 150,048,848 probably null Het
Slc45a1 T C 4: 150,638,594 S278G possibly damaging Het
Smurf1 A G 5: 144,886,369 I455T possibly damaging Het
Speg T C 1: 75,430,913 L3188P probably damaging Het
Tcaf3 G T 6: 42,597,125 A51D probably damaging Het
Tecrl T C 5: 83,354,921 N12S possibly damaging Het
Tmem17 T A 11: 22,518,508 I149N possibly damaging Het
Tmem171 A G 13: 98,692,468 V58A possibly damaging Het
Ttn A G 2: 76,861,177 probably benign Het
Ubqln5 A G 7: 104,128,601 S339P probably benign Het
Vmn1r16 T A 6: 57,323,488 I50L probably benign Het
Vmn2r103 A T 17: 19,793,477 Y177F probably benign Het
Zfp28 C A 7: 6,394,693 T709K probably damaging Het
Zfp958 A G 8: 4,626,170 N46S probably benign Het
Zyx T A 6: 42,350,357 V30E unknown Het
Other mutations in Cspg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Cspg4 APN 9 56898865 missense probably damaging 1.00
IGL01322:Cspg4 APN 9 56898588 missense probably damaging 1.00
IGL01922:Cspg4 APN 9 56887887 missense probably damaging 1.00
IGL01993:Cspg4 APN 9 56898478 missense probably benign 0.09
IGL02379:Cspg4 APN 9 56892609 splice site probably benign
IGL02398:Cspg4 APN 9 56886686 missense probably benign 0.43
IGL02503:Cspg4 APN 9 56897403 missense probably damaging 1.00
IGL02504:Cspg4 APN 9 56885772 missense probably benign 0.06
IGL02692:Cspg4 APN 9 56887454 missense probably benign 0.00
IGL02728:Cspg4 APN 9 56886481 missense probably damaging 1.00
IGL02806:Cspg4 APN 9 56890259 missense possibly damaging 0.57
IGL02886:Cspg4 APN 9 56897388 missense probably damaging 0.99
IGL03005:Cspg4 APN 9 56888488 missense probably damaging 1.00
IGL03008:Cspg4 APN 9 56898475 missense possibly damaging 0.48
IGL03202:Cspg4 APN 9 56897739 missense possibly damaging 0.93
chiclets UTSW 9 56885222 splice site probably null
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0254:Cspg4 UTSW 9 56897410 missense probably damaging 0.98
R0284:Cspg4 UTSW 9 56886139 missense probably damaging 0.96
R0513:Cspg4 UTSW 9 56898091 missense probably benign 0.03
R0602:Cspg4 UTSW 9 56888017 missense probably damaging 1.00
R0747:Cspg4 UTSW 9 56890280 missense probably damaging 1.00
R1005:Cspg4 UTSW 9 56888736 missense probably benign 0.13
R1421:Cspg4 UTSW 9 56896626 missense probably benign 0.00
R1443:Cspg4 UTSW 9 56886512 missense probably damaging 1.00
R1481:Cspg4 UTSW 9 56887810 missense probably damaging 0.98
R1585:Cspg4 UTSW 9 56898867 missense probably damaging 0.99
R1624:Cspg4 UTSW 9 56888470 missense probably damaging 1.00
R1670:Cspg4 UTSW 9 56897403 missense probably damaging 1.00
R1721:Cspg4 UTSW 9 56888743 missense probably damaging 0.98
R1728:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1729:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1763:Cspg4 UTSW 9 56886979 missense probably damaging 0.97
R1772:Cspg4 UTSW 9 56897492 missense probably benign 0.02
R1938:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R1975:Cspg4 UTSW 9 56890478 missense probably damaging 1.00
R2064:Cspg4 UTSW 9 56896656 missense probably damaging 1.00
R2185:Cspg4 UTSW 9 56886972 missense probably benign 0.37
R2252:Cspg4 UTSW 9 56898046 missense probably damaging 1.00
R2291:Cspg4 UTSW 9 56892743 missense probably damaging 0.96
R2329:Cspg4 UTSW 9 56888550 missense probably benign 0.00
R3780:Cspg4 UTSW 9 56888233 missense probably damaging 1.00
R3830:Cspg4 UTSW 9 56897621 missense probably damaging 0.99
R3944:Cspg4 UTSW 9 56886123 missense probably damaging 1.00
R4011:Cspg4 UTSW 9 56887317 missense probably benign 0.19
R4115:Cspg4 UTSW 9 56898394 missense probably damaging 1.00
R4173:Cspg4 UTSW 9 56887930 missense probably damaging 1.00
R4243:Cspg4 UTSW 9 56887857 missense probably benign 0.12
R4329:Cspg4 UTSW 9 56892465 missense probably damaging 0.99
R4544:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4545:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4546:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4649:Cspg4 UTSW 9 56886865 missense possibly damaging 0.93
R4663:Cspg4 UTSW 9 56886676 missense possibly damaging 0.61
R4674:Cspg4 UTSW 9 56898205 missense probably damaging 1.00
R4779:Cspg4 UTSW 9 56885808 missense probably damaging 1.00
R4884:Cspg4 UTSW 9 56898069 missense probably benign 0.00
R5021:Cspg4 UTSW 9 56897730 missense probably benign 0.01
R5051:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
R5328:Cspg4 UTSW 9 56885856 missense probably benign 0.01
R5394:Cspg4 UTSW 9 56890200 missense probably damaging 1.00
R5567:Cspg4 UTSW 9 56886648 missense probably benign 0.00
R5682:Cspg4 UTSW 9 56886196 missense probably benign 0.14
R5690:Cspg4 UTSW 9 56898735 missense probably benign 0.01
R5715:Cspg4 UTSW 9 56891051 missense possibly damaging 0.90
R5717:Cspg4 UTSW 9 56885798 missense probably benign
R5726:Cspg4 UTSW 9 56885904 missense probably damaging 1.00
R5898:Cspg4 UTSW 9 56885222 splice site probably null
R6140:Cspg4 UTSW 9 56897224 missense probably benign 0.35
R6147:Cspg4 UTSW 9 56888772 missense probably damaging 0.99
R6239:Cspg4 UTSW 9 56888182 missense probably benign 0.04
R6343:Cspg4 UTSW 9 56892692 missense probably benign
R6351:Cspg4 UTSW 9 56892644 missense probably benign 0.00
R6564:Cspg4 UTSW 9 56890158 missense probably benign 0.02
R6814:Cspg4 UTSW 9 56890340 missense possibly damaging 0.91
R6928:Cspg4 UTSW 9 56897880 missense possibly damaging 0.95
R6967:Cspg4 UTSW 9 56890136 missense possibly damaging 0.52
R7033:Cspg4 UTSW 9 56888074 missense probably damaging 0.96
R7419:Cspg4 UTSW 9 56888443 missense possibly damaging 0.94
R7809:Cspg4 UTSW 9 56890190 missense probably damaging 1.00
R7940:Cspg4 UTSW 9 56888097 nonsense probably null
R8078:Cspg4 UTSW 9 56890259 missense possibly damaging 0.57
R8082:Cspg4 UTSW 9 56885893 missense probably damaging 1.00
R8217:Cspg4 UTSW 9 56890353 missense possibly damaging 0.53
R8237:Cspg4 UTSW 9 56892680 missense probably damaging 1.00
R8353:Cspg4 UTSW 9 56898669 missense probably damaging 1.00
R8372:Cspg4 UTSW 9 56887195 missense probably damaging 1.00
R8691:Cspg4 UTSW 9 56892996 missense probably benign
R8720:Cspg4 UTSW 9 56887513 missense probably benign 0.25
R8907:Cspg4 UTSW 9 56883683 missense probably damaging 1.00
R9063:Cspg4 UTSW 9 56888403 missense probably benign 0.03
R9115:Cspg4 UTSW 9 56890452 missense probably damaging 1.00
R9152:Cspg4 UTSW 9 56888179 missense probably benign 0.26
R9154:Cspg4 UTSW 9 56891003 missense
R9361:Cspg4 UTSW 9 56896593 missense probably damaging 1.00
R9574:Cspg4 UTSW 9 56890058 missense probably damaging 1.00
R9608:Cspg4 UTSW 9 56885552 missense probably benign
R9685:Cspg4 UTSW 9 56890338 missense probably benign 0.05
X0065:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
Z1088:Cspg4 UTSW 9 56886036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTCCGGGTCAGTGATG -3'
(R):5'- CAGATTGCTCAGTGTCTCCTG -3'

Sequencing Primer
(F):5'- TCAGTGATGGGATGCAGGCC -3'
(R):5'- AGTGTCTCCTGGCCCAC -3'
Posted On 2018-11-28