Mutagenetix > Incidental Mutations

Incidental Mutation 'R6981:Cspg4'

542686

Institutional Source

Beutler Lab

Gene Symbol

Cspg4

Ensembl Gene

ENSMUSG00000032911

Gene Name

chondroitin sulfate proteoglycan 4

Synonyms

AN2, 4732461B14Rik, NG2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6981 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56865033-56899870 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56887101 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 707 (T707A)

Ref Sequence

ENSEMBL: ENSMUSP00000038909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035661]

AlphaFold

Q8VHY0

Predicted Effect

probably benign
Transcript: ENSMUST00000035661
AA Change: T707A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: T707A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
LamG	47	179	9.16e-22	SMART
LamG	223	364	3.52e-23	SMART
low complexity region	384	397	N/A	INTRINSIC
Pfam:Cadherin_3	495	646	1e-36	PFAM
Pfam:Cadherin_3	732	885	7.9e-14	PFAM
Pfam:Cadherin_3	868	996	7e-15	PFAM
Pfam:Cadherin_3	972	1115	9e-26	PFAM
Pfam:Cadherin_3	1116	1223	1.1e-10	PFAM
Pfam:Cadherin_3	1225	1344	3.3e-12	PFAM
Pfam:Cadherin_3	1425	1568	6.3e-52	PFAM
Pfam:Cadherin_3	1578	1684	9.7e-9	PFAM
Pfam:Cadherin_3	1674	1809	3.2e-9	PFAM
Pfam:Cadherin_3	1779	1929	1.6e-31	PFAM
transmembrane domain	2229	2251	N/A	INTRINSIC
low complexity region	2295	2305	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215666

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	A	11: 58,293,718		probably benign	Het
5031439G07Rik	A	C	15: 84,949,597	Y419*	probably null	Het
Abca2	T	A	2: 25,444,139	F1809L	probably damaging	Het
Ache	C	T	5: 137,291,678	T423I	probably benign	Het
Acvrl1	A	G	15: 101,138,345	T395A	probably damaging	Het
Ap3b2	A	G	7: 81,477,993	I145T	probably damaging	Het
Arhgef4	A	C	1: 34,722,452	Q263P	unknown	Het
Asgr2	C	T	11: 70,096,810	L45F	probably damaging	Het
Baiap2l1	T	A	5: 144,285,579	Y122F	possibly damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Car8	A	T	4: 8,185,650		probably null	Het
Carns1	T	C	19: 4,170,082	T385A	probably benign	Het
Ccdc47	T	C	11: 106,202,737	T41A	probably benign	Het
Ccne1	A	T	7: 38,098,573		probably benign	Het
Cdh4	C	T	2: 179,797,504	T148I	probably benign	Het
Cep85	C	T	4: 134,152,261	R392Q	probably damaging	Het
Ces1h	T	C	8: 93,353,495	T464A	unknown	Het
Cfl1	T	A	19: 5,492,616	S41R	possibly damaging	Het
Crnn	T	C	3: 93,148,135	V76A	probably damaging	Het
Dgkh	A	T	14: 78,627,742	C53*	probably null	Het
Dhx34	G	T	7: 16,215,330	A391E	possibly damaging	Het
Dlx1	C	A	2: 71,532,353	N201K	probably benign	Het
Dnah6	T	C	6: 73,021,178	E4087G	probably benign	Het
Dock6	T	C	9: 21,845,550	Y134C	probably damaging	Het
Duox2	A	G	2: 122,291,227	V662A	possibly damaging	Het
Dusp12	A	G	1: 170,880,961	F12L	probably damaging	Het
Eppk1	T	C	15: 76,111,037	E548G	probably benign	Het
Foxj2	A	G	6: 122,828,444	I92V	probably damaging	Het
Foxj2	A	G	6: 122,842,839	D562G	probably benign	Het
Gm17728	A	G	17: 9,422,159	R34G	probably damaging	Het
Gpc6	T	C	14: 117,624,548	I292T	probably damaging	Het
Gpr15	T	A	16: 58,718,185	K180N	probably benign	Het
Gtf2ird1	G	T	5: 134,383,922		probably benign	Het
Hist1h2ah	A	G	13: 22,035,549	S2P	probably benign	Het
Hps3	T	A	3: 20,022,820	T393S	probably damaging	Het
Hspa1a	A	T	17: 34,970,291		probably null	Het
Hydin	A	G	8: 110,531,072	E2378G	possibly damaging	Het
Ighv1-18	A	G	12: 114,682,678	L102P	probably damaging	Het
Itga5	T	A	15: 103,350,226	N814I	probably benign	Het
Kcnb2	T	C	1: 15,710,256	S451P	probably damaging	Het
Klhl32	T	G	4: 24,709,030	I112L	probably damaging	Het
Knstrn	T	G	2: 118,834,094	I47R	possibly damaging	Het
Med23	T	A	10: 24,895,824	S581T	possibly damaging	Het
Mgat5	C	T	1: 127,390,851	T361I	probably damaging	Het
Nipal3	A	G	4: 135,479,547	V112A	probably damaging	Het
Olfr1287	T	C	2: 111,449,352	F71L	probably benign	Het
Olfr1359	A	G	13: 21,703,073	E24G	probably benign	Het
Olfr713	T	A	7: 107,036,749	V198D	possibly damaging	Het
Olfr996	A	G	2: 85,579,481	M81V	probably benign	Het
Paxip1	G	A	5: 27,765,768	Q528*	probably null	Het
Proser2	T	C	2: 6,113,990	D14G	probably damaging	Het
Rp1	T	G	1: 4,345,655	I1745L	probably benign	Het
Rxfp2	G	T	5: 150,048,848		probably null	Het
Slc45a1	T	C	4: 150,638,594	S278G	possibly damaging	Het
Smurf1	A	G	5: 144,886,369	I455T	possibly damaging	Het
Speg	T	C	1: 75,430,913	L3188P	probably damaging	Het
Tcaf3	G	T	6: 42,597,125	A51D	probably damaging	Het
Tecrl	T	C	5: 83,354,921	N12S	possibly damaging	Het
Tmem17	T	A	11: 22,518,508	I149N	possibly damaging	Het
Tmem171	A	G	13: 98,692,468	V58A	possibly damaging	Het
Ttn	A	G	2: 76,861,177		probably benign	Het
Ubqln5	A	G	7: 104,128,601	S339P	probably benign	Het
Vmn1r16	T	A	6: 57,323,488	I50L	probably benign	Het
Vmn2r103	A	T	17: 19,793,477	Y177F	probably benign	Het
Zfp28	C	A	7: 6,394,693	T709K	probably damaging	Het
Zfp958	A	G	8: 4,626,170	N46S	probably benign	Het
Zyx	T	A	6: 42,350,357	V30E	unknown	Het

Other mutations in Cspg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Cspg4	APN	9	56898865	missense	probably damaging	1.00
IGL01322:Cspg4	APN	9	56898588	missense	probably damaging	1.00
IGL01922:Cspg4	APN	9	56887887	missense	probably damaging	1.00
IGL01993:Cspg4	APN	9	56898478	missense	probably benign	0.09
IGL02379:Cspg4	APN	9	56892609	splice site	probably benign
IGL02398:Cspg4	APN	9	56886686	missense	probably benign	0.43
IGL02503:Cspg4	APN	9	56897403	missense	probably damaging	1.00
IGL02504:Cspg4	APN	9	56885772	missense	probably benign	0.06
IGL02692:Cspg4	APN	9	56887454	missense	probably benign	0.00
IGL02728:Cspg4	APN	9	56886481	missense	probably damaging	1.00
IGL02806:Cspg4	APN	9	56890259	missense	possibly damaging	0.57
IGL02886:Cspg4	APN	9	56897388	missense	probably damaging	0.99
IGL03005:Cspg4	APN	9	56888488	missense	probably damaging	1.00
IGL03008:Cspg4	APN	9	56898475	missense	possibly damaging	0.48
IGL03202:Cspg4	APN	9	56897739	missense	possibly damaging	0.93
chiclets	UTSW	9	56885222	splice site	probably null
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0254:Cspg4	UTSW	9	56897410	missense	probably damaging	0.98
R0284:Cspg4	UTSW	9	56886139	missense	probably damaging	0.96
R0513:Cspg4	UTSW	9	56898091	missense	probably benign	0.03
R0602:Cspg4	UTSW	9	56888017	missense	probably damaging	1.00
R0747:Cspg4	UTSW	9	56890280	missense	probably damaging	1.00
R1005:Cspg4	UTSW	9	56888736	missense	probably benign	0.13
R1421:Cspg4	UTSW	9	56896626	missense	probably benign	0.00
R1443:Cspg4	UTSW	9	56886512	missense	probably damaging	1.00
R1481:Cspg4	UTSW	9	56887810	missense	probably damaging	0.98
R1585:Cspg4	UTSW	9	56898867	missense	probably damaging	0.99
R1624:Cspg4	UTSW	9	56888470	missense	probably damaging	1.00
R1670:Cspg4	UTSW	9	56897403	missense	probably damaging	1.00
R1721:Cspg4	UTSW	9	56888743	missense	probably damaging	0.98
R1728:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1729:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1763:Cspg4	UTSW	9	56886979	missense	probably damaging	0.97
R1772:Cspg4	UTSW	9	56897492	missense	probably benign	0.02
R1938:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R1975:Cspg4	UTSW	9	56890478	missense	probably damaging	1.00
R2064:Cspg4	UTSW	9	56896656	missense	probably damaging	1.00
R2185:Cspg4	UTSW	9	56886972	missense	probably benign	0.37
R2252:Cspg4	UTSW	9	56898046	missense	probably damaging	1.00
R2291:Cspg4	UTSW	9	56892743	missense	probably damaging	0.96
R2329:Cspg4	UTSW	9	56888550	missense	probably benign	0.00
R3780:Cspg4	UTSW	9	56888233	missense	probably damaging	1.00
R3830:Cspg4	UTSW	9	56897621	missense	probably damaging	0.99
R3944:Cspg4	UTSW	9	56886123	missense	probably damaging	1.00
R4011:Cspg4	UTSW	9	56887317	missense	probably benign	0.19
R4115:Cspg4	UTSW	9	56898394	missense	probably damaging	1.00
R4173:Cspg4	UTSW	9	56887930	missense	probably damaging	1.00
R4243:Cspg4	UTSW	9	56887857	missense	probably benign	0.12
R4329:Cspg4	UTSW	9	56892465	missense	probably damaging	0.99
R4544:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4545:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4546:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4649:Cspg4	UTSW	9	56886865	missense	possibly damaging	0.93
R4663:Cspg4	UTSW	9	56886676	missense	possibly damaging	0.61
R4674:Cspg4	UTSW	9	56898205	missense	probably damaging	1.00
R4779:Cspg4	UTSW	9	56885808	missense	probably damaging	1.00
R4884:Cspg4	UTSW	9	56898069	missense	probably benign	0.00
R5021:Cspg4	UTSW	9	56897730	missense	probably benign	0.01
R5051:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
R5328:Cspg4	UTSW	9	56885856	missense	probably benign	0.01
R5394:Cspg4	UTSW	9	56890200	missense	probably damaging	1.00
R5567:Cspg4	UTSW	9	56886648	missense	probably benign	0.00
R5682:Cspg4	UTSW	9	56886196	missense	probably benign	0.14
R5690:Cspg4	UTSW	9	56898735	missense	probably benign	0.01
R5715:Cspg4	UTSW	9	56891051	missense	possibly damaging	0.90
R5717:Cspg4	UTSW	9	56885798	missense	probably benign
R5726:Cspg4	UTSW	9	56885904	missense	probably damaging	1.00
R5898:Cspg4	UTSW	9	56885222	splice site	probably null
R6140:Cspg4	UTSW	9	56897224	missense	probably benign	0.35
R6147:Cspg4	UTSW	9	56888772	missense	probably damaging	0.99
R6239:Cspg4	UTSW	9	56888182	missense	probably benign	0.04
R6343:Cspg4	UTSW	9	56892692	missense	probably benign
R6351:Cspg4	UTSW	9	56892644	missense	probably benign	0.00
R6564:Cspg4	UTSW	9	56890158	missense	probably benign	0.02
R6814:Cspg4	UTSW	9	56890340	missense	possibly damaging	0.91
R6928:Cspg4	UTSW	9	56897880	missense	possibly damaging	0.95
R6967:Cspg4	UTSW	9	56890136	missense	possibly damaging	0.52
R7033:Cspg4	UTSW	9	56888074	missense	probably damaging	0.96
R7419:Cspg4	UTSW	9	56888443	missense	possibly damaging	0.94
R7809:Cspg4	UTSW	9	56890190	missense	probably damaging	1.00
R7940:Cspg4	UTSW	9	56888097	nonsense	probably null
R8078:Cspg4	UTSW	9	56890259	missense	possibly damaging	0.57
R8082:Cspg4	UTSW	9	56885893	missense	probably damaging	1.00
R8217:Cspg4	UTSW	9	56890353	missense	possibly damaging	0.53
R8237:Cspg4	UTSW	9	56892680	missense	probably damaging	1.00
R8353:Cspg4	UTSW	9	56898669	missense	probably damaging	1.00
R8372:Cspg4	UTSW	9	56887195	missense	probably damaging	1.00
R8691:Cspg4	UTSW	9	56892996	missense	probably benign
R8720:Cspg4	UTSW	9	56887513	missense	probably benign	0.25
R8907:Cspg4	UTSW	9	56883683	missense	probably damaging	1.00
R9063:Cspg4	UTSW	9	56888403	missense	probably benign	0.03
R9115:Cspg4	UTSW	9	56890452	missense	probably damaging	1.00
R9152:Cspg4	UTSW	9	56888179	missense	probably benign	0.26
R9154:Cspg4	UTSW	9	56891003	missense
R9361:Cspg4	UTSW	9	56896593	missense	probably damaging	1.00
X0065:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
Z1088:Cspg4	UTSW	9	56886036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACATTCCGGGTCAGTGATG -3'
(R):5'- CAGATTGCTCAGTGTCTCCTG -3'

Sequencing Primer
(F):5'- TCAGTGATGGGATGCAGGCC -3'
(R):5'- AGTGTCTCCTGGCCCAC -3'

Posted On

2018-11-28