Incidental Mutation 'R6981:Asgr2'
ID542690
Institutional Source Beutler Lab
Gene Symbol Asgr2
Ensembl Gene ENSMUSG00000040963
Gene Nameasialoglycoprotein receptor 2
SynonymsASGPR2, Asgr-2, Asgr
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6981 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70092644-70106187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70096810 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 45 (L45F)
Ref Sequence ENSEMBL: ENSMUSP00000121189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102572] [ENSMUST00000124721] [ENSMUST00000143772]
Predicted Effect probably damaging
Transcript: ENSMUST00000102572
AA Change: L45F

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099632
Gene: ENSMUSG00000040963
AA Change: L45F

DomainStartEndE-ValueType
Pfam:Lectin_N 29 162 1.5e-58 PFAM
CLECT 170 294 3.51e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124721
AA Change: L45F

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121189
Gene: ENSMUSG00000040963
AA Change: L45F

DomainStartEndE-ValueType
Pfam:Lectin_N 25 162 1e-69 PFAM
CLECT 170 226 1.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143772
SMART Domains Protein: ENSMUSP00000136505
Gene: ENSMUSG00000040963

DomainStartEndE-ValueType
Pfam:Lectin_N 1 59 7.5e-27 PFAM
CLECT 67 191 3.51e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in reduced ASGR1 protein expression and deficiency in clearance of asialoorsomucoid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,293,718 probably benign Het
5031439G07Rik A C 15: 84,949,597 Y419* probably null Het
Abca2 T A 2: 25,444,139 F1809L probably damaging Het
Ache C T 5: 137,291,678 T423I probably benign Het
Acvrl1 A G 15: 101,138,345 T395A probably damaging Het
Ap3b2 A G 7: 81,477,993 I145T probably damaging Het
Arhgef4 A C 1: 34,722,452 Q263P unknown Het
Baiap2l1 T A 5: 144,285,579 Y122F possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Car8 A T 4: 8,185,650 probably null Het
Carns1 T C 19: 4,170,082 T385A probably benign Het
Ccdc47 T C 11: 106,202,737 T41A probably benign Het
Ccne1 A T 7: 38,098,573 probably benign Het
Cdh4 C T 2: 179,797,504 T148I probably benign Het
Cep85 C T 4: 134,152,261 R392Q probably damaging Het
Ces1h T C 8: 93,353,495 T464A unknown Het
Cfl1 T A 19: 5,492,616 S41R possibly damaging Het
Crnn T C 3: 93,148,135 V76A probably damaging Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Dgkh A T 14: 78,627,742 C53* probably null Het
Dhx34 G T 7: 16,215,330 A391E possibly damaging Het
Dlx1 C A 2: 71,532,353 N201K probably benign Het
Dnah6 T C 6: 73,021,178 E4087G probably benign Het
Dock6 T C 9: 21,845,550 Y134C probably damaging Het
Duox2 A G 2: 122,291,227 V662A possibly damaging Het
Dusp12 A G 1: 170,880,961 F12L probably damaging Het
Eppk1 T C 15: 76,111,037 E548G probably benign Het
Foxj2 A G 6: 122,828,444 I92V probably damaging Het
Foxj2 A G 6: 122,842,839 D562G probably benign Het
Gm17728 A G 17: 9,422,159 R34G probably damaging Het
Gpc6 T C 14: 117,624,548 I292T probably damaging Het
Gpr15 T A 16: 58,718,185 K180N probably benign Het
Gtf2ird1 G T 5: 134,383,922 probably benign Het
Hist1h2ah A G 13: 22,035,549 S2P probably benign Het
Hps3 T A 3: 20,022,820 T393S probably damaging Het
Hspa1a A T 17: 34,970,291 probably null Het
Hydin A G 8: 110,531,072 E2378G possibly damaging Het
Ighv1-18 A G 12: 114,682,678 L102P probably damaging Het
Itga5 T A 15: 103,350,226 N814I probably benign Het
Kcnb2 T C 1: 15,710,256 S451P probably damaging Het
Klhl32 T G 4: 24,709,030 I112L probably damaging Het
Knstrn T G 2: 118,834,094 I47R possibly damaging Het
Med23 T A 10: 24,895,824 S581T possibly damaging Het
Mgat5 C T 1: 127,390,851 T361I probably damaging Het
Nipal3 A G 4: 135,479,547 V112A probably damaging Het
Olfr1287 T C 2: 111,449,352 F71L probably benign Het
Olfr1359 A G 13: 21,703,073 E24G probably benign Het
Olfr713 T A 7: 107,036,749 V198D possibly damaging Het
Olfr996 A G 2: 85,579,481 M81V probably benign Het
Paxip1 G A 5: 27,765,768 Q528* probably null Het
Proser2 T C 2: 6,113,990 D14G probably damaging Het
Rp1 T G 1: 4,345,655 I1745L probably benign Het
Rxfp2 G T 5: 150,048,848 probably null Het
Slc45a1 T C 4: 150,638,594 S278G possibly damaging Het
Smurf1 A G 5: 144,886,369 I455T possibly damaging Het
Speg T C 1: 75,430,913 L3188P probably damaging Het
Tcaf3 G T 6: 42,597,125 A51D probably damaging Het
Tecrl T C 5: 83,354,921 N12S possibly damaging Het
Tmem17 T A 11: 22,518,508 I149N possibly damaging Het
Tmem171 A G 13: 98,692,468 V58A possibly damaging Het
Ttn A G 2: 76,861,177 probably benign Het
Ubqln5 A G 7: 104,128,601 S339P probably benign Het
Vmn1r16 T A 6: 57,323,488 I50L probably benign Het
Vmn2r103 A T 17: 19,793,477 Y177F probably benign Het
Zfp28 C A 7: 6,394,693 T709K probably damaging Het
Zfp958 A G 8: 4,626,170 N46S probably benign Het
Zyx T A 6: 42,350,357 V30E unknown Het
Other mutations in Asgr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Asgr2 APN 11 70105367 splice site probably benign
IGL01936:Asgr2 APN 11 70098051 critical splice acceptor site probably null
IGL02827:Asgr2 APN 11 70096897 missense probably benign 0.05
IGL03034:Asgr2 APN 11 70098263 missense probably damaging 0.99
R0569:Asgr2 UTSW 11 70097877 missense probably benign 0.04
R1240:Asgr2 UTSW 11 70096850 missense possibly damaging 0.81
R1748:Asgr2 UTSW 11 70096832 missense probably damaging 0.99
R1920:Asgr2 UTSW 11 70098297 missense possibly damaging 0.93
R3016:Asgr2 UTSW 11 70105409 missense probably damaging 0.97
R4293:Asgr2 UTSW 11 70098231 missense probably benign 0.43
R4423:Asgr2 UTSW 11 70105385 missense probably benign 0.44
R4988:Asgr2 UTSW 11 70097839 missense probably benign 0.05
R6224:Asgr2 UTSW 11 70098246 missense probably damaging 0.98
R7715:Asgr2 UTSW 11 70096895 missense probably benign 0.01
R7768:Asgr2 UTSW 11 70105416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATATCCCGTCACTGCTC -3'
(R):5'- TGATCTCCATCTGCACCCAG -3'

Sequencing Primer
(F):5'- ACTGCTCCATTCTGAAGGGACAG -3'
(R):5'- TCACTGCCCCAGCACTG -3'
Posted On2018-11-28