Mutagenetix > Incidental Mutation

Incidental Mutation 'R6981:Carns1'

542706

Institutional Source

Beutler Lab

Gene Symbol

Carns1

Ensembl Gene

ENSMUSG00000075289

Gene Name

carnosine synthase 1

Synonyms

Atpgd1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R6981 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4164324-4175479 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4170082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 385 (T385A)

Ref Sequence

ENSEMBL: ENSMUSP00000131624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167055]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167055
AA Change: T385A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000131624
Gene: ENSMUSG00000075289
AA Change: T385A

Domain	Start	End	E-Value	Type
low complexity region	206	217	N/A	INTRINSIC
low complexity region	312	328	N/A	INTRINSIC
low complexity region	332	348	N/A	INTRINSIC
low complexity region	399	410	N/A	INTRINSIC
low complexity region	414	433	N/A	INTRINSIC
low complexity region	490	496	N/A	INTRINSIC
Pfam:ATP-grasp_4	620	819	4.1e-46	PFAM
low complexity region	862	875	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CARNS1 (EC 6.3.2.11), a member of the ATP-grasp family of ATPases, catalyzes the formation of carnosine (beta-alanyl-L-histidine) and homocarnosine (gamma-aminobutyryl-L-histidine), which are found mainly in skeletal muscle and the central nervous system, respectively (Drozak et al., 2010 [PubMed 20097752]).[supplied by OMIM, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	G	A	11: 58,293,718		probably benign	Het
5031439G07Rik	A	C	15: 84,949,597	Y419*	probably null	Het
Abca2	T	A	2: 25,444,139	F1809L	probably damaging	Het
Ache	C	T	5: 137,291,678	T423I	probably benign	Het
Acvrl1	A	G	15: 101,138,345	T395A	probably damaging	Het
Ap3b2	A	G	7: 81,477,993	I145T	probably damaging	Het
Arhgef4	A	C	1: 34,722,452	Q263P	unknown	Het
Asgr2	C	T	11: 70,096,810	L45F	probably damaging	Het
Baiap2l1	T	A	5: 144,285,579	Y122F	possibly damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Car8	A	T	4: 8,185,650		probably null	Het
Ccdc47	T	C	11: 106,202,737	T41A	probably benign	Het
Ccne1	A	T	7: 38,098,573		probably benign	Het
Cdh4	C	T	2: 179,797,504	T148I	probably benign	Het
Cep85	C	T	4: 134,152,261	R392Q	probably damaging	Het
Ces1h	T	C	8: 93,353,495	T464A	unknown	Het
Cfl1	T	A	19: 5,492,616	S41R	possibly damaging	Het
Crnn	T	C	3: 93,148,135	V76A	probably damaging	Het
Cspg4	A	G	9: 56,887,101	T707A	probably benign	Het
Dgkh	A	T	14: 78,627,742	C53*	probably null	Het
Dhx34	G	T	7: 16,215,330	A391E	possibly damaging	Het
Dlx1	C	A	2: 71,532,353	N201K	probably benign	Het
Dnah6	T	C	6: 73,021,178	E4087G	probably benign	Het
Dock6	T	C	9: 21,845,550	Y134C	probably damaging	Het
Duox2	A	G	2: 122,291,227	V662A	possibly damaging	Het
Dusp12	A	G	1: 170,880,961	F12L	probably damaging	Het
Eppk1	T	C	15: 76,111,037	E548G	probably benign	Het
Foxj2	A	G	6: 122,828,444	I92V	probably damaging	Het
Foxj2	A	G	6: 122,842,839	D562G	probably benign	Het
Gm17728	A	G	17: 9,422,159	R34G	probably damaging	Het
Gpc6	T	C	14: 117,624,548	I292T	probably damaging	Het
Gpr15	T	A	16: 58,718,185	K180N	probably benign	Het
Gtf2ird1	G	T	5: 134,383,922		probably benign	Het
Hist1h2ah	A	G	13: 22,035,549	S2P	probably benign	Het
Hps3	T	A	3: 20,022,820	T393S	probably damaging	Het
Hspa1a	A	T	17: 34,970,291		probably null	Het
Hydin	A	G	8: 110,531,072	E2378G	possibly damaging	Het
Ighv1-18	A	G	12: 114,682,678	L102P	probably damaging	Het
Itga5	T	A	15: 103,350,226	N814I	probably benign	Het
Kcnb2	T	C	1: 15,710,256	S451P	probably damaging	Het
Klhl32	T	G	4: 24,709,030	I112L	probably damaging	Het
Knstrn	T	G	2: 118,834,094	I47R	possibly damaging	Het
Med23	T	A	10: 24,895,824	S581T	possibly damaging	Het
Mgat5	C	T	1: 127,390,851	T361I	probably damaging	Het
Nipal3	A	G	4: 135,479,547	V112A	probably damaging	Het
Olfr1287	T	C	2: 111,449,352	F71L	probably benign	Het
Olfr1359	A	G	13: 21,703,073	E24G	probably benign	Het
Olfr713	T	A	7: 107,036,749	V198D	possibly damaging	Het
Olfr996	A	G	2: 85,579,481	M81V	probably benign	Het
Paxip1	G	A	5: 27,765,768	Q528*	probably null	Het
Proser2	T	C	2: 6,113,990	D14G	probably damaging	Het
Rp1	T	G	1: 4,345,655	I1745L	probably benign	Het
Rxfp2	G	T	5: 150,048,848		probably null	Het
Slc45a1	T	C	4: 150,638,594	S278G	possibly damaging	Het
Smurf1	A	G	5: 144,886,369	I455T	possibly damaging	Het
Speg	T	C	1: 75,430,913	L3188P	probably damaging	Het
Tcaf3	G	T	6: 42,597,125	A51D	probably damaging	Het
Tecrl	T	C	5: 83,354,921	N12S	possibly damaging	Het
Tmem17	T	A	11: 22,518,508	I149N	possibly damaging	Het
Tmem171	A	G	13: 98,692,468	V58A	possibly damaging	Het
Ttn	A	G	2: 76,861,177		probably benign	Het
Ubqln5	A	G	7: 104,128,601	S339P	probably benign	Het
Vmn1r16	T	A	6: 57,323,488	I50L	probably benign	Het
Vmn2r103	A	T	17: 19,793,477	Y177F	probably benign	Het
Zfp28	C	A	7: 6,394,693	T709K	probably damaging	Het
Zfp958	A	G	8: 4,626,170	N46S	probably benign	Het
Zyx	T	A	6: 42,350,357	V30E	unknown	Het

Other mutations in Carns1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Carns1	APN	19	4166499	splice site	probably null
IGL02246:Carns1	APN	19	4166432	missense	possibly damaging	0.87
IGL02658:Carns1	APN	19	4173084	missense	probably benign	0.01
IGL02800:Carns1	APN	19	4166570	splice site	probably benign
R1750:Carns1	UTSW	19	4173157	missense	possibly damaging	0.63
R1902:Carns1	UTSW	19	4166338	missense	probably damaging	1.00
R1935:Carns1	UTSW	19	4165474	missense	probably damaging	1.00
R2434:Carns1	UTSW	19	4165449	missense	probably damaging	1.00
R2437:Carns1	UTSW	19	4165783	missense	possibly damaging	0.69
R3772:Carns1	UTSW	19	4170916	splice site	probably benign
R4091:Carns1	UTSW	19	4171683	missense	probably damaging	0.96
R4518:Carns1	UTSW	19	4170070	missense	probably benign	0.05
R4668:Carns1	UTSW	19	4165476	nonsense	probably null
R4737:Carns1	UTSW	19	4170928	intron	probably benign
R4751:Carns1	UTSW	19	4166418	missense	probably damaging	1.00
R5384:Carns1	UTSW	19	4171901	critical splice acceptor site	probably null
R6077:Carns1	UTSW	19	4170876	missense	probably benign	0.01
R6373:Carns1	UTSW	19	4166516	missense	probably benign	0.41
R6411:Carns1	UTSW	19	4166464	missense	probably damaging	1.00
R6470:Carns1	UTSW	19	4171783	missense	possibly damaging	0.85
R6486:Carns1	UTSW	19	4169980	missense	probably benign	0.04
R6915:Carns1	UTSW	19	4169913	missense	probably benign	0.34
R7936:Carns1	UTSW	19	4166153	missense	probably benign
R8025:Carns1	UTSW	19	4166506	missense	probably damaging	1.00
R9279:Carns1	UTSW	19	4166257	missense	possibly damaging	0.51
R9711:Carns1	UTSW	19	4166008	missense	possibly damaging	0.94
R9725:Carns1	UTSW	19	4166549	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAAGTCGGTGTGCACTTG -3'
(R):5'- TCAGATGGCCAGTGATGCTG -3'

Sequencing Primer
(F):5'- CACTTGGCGTCCACCAC -3'
(R):5'- TAGGTCTTGATGAAGAAAGGGTTC -3'

Posted On

2018-11-28