Incidental Mutation 'R6981:Cfl1'
ID542707
Institutional Source Beutler Lab
Gene Symbol Cfl1
Ensembl Gene ENSMUSG00000056201
Gene Namecofilin 1, non-muscle
SynonymsCof, n-cofilin, cofilin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6981 (G1)
Quality Score221.009
Status Validated
Chromosome19
Chromosomal Location5490455-5495201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5492616 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 41 (S41R)
Ref Sequence ENSEMBL: ENSMUSP00000112259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025841] [ENSMUST00000070172] [ENSMUST00000116560] [ENSMUST00000124334] [ENSMUST00000126471] [ENSMUST00000209469]
Predicted Effect probably benign
Transcript: ENSMUST00000025841
SMART Domains Protein: ENSMUSP00000025841
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 7e-3 SMART
PDB:2KP7|A 11 90 5e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 1e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070172
SMART Domains Protein: ENSMUSP00000070915
Gene: ENSMUSG00000056185

DomainStartEndE-ValueType
Pfam:PX 24 165 1.4e-19 PFAM
Pfam:Vps5 183 394 9.9e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116560
AA Change: S41R

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112259
Gene: ENSMUSG00000056201
AA Change: S41R

DomainStartEndE-ValueType
ADF 19 154 5.3e-56 SMART
low complexity region 195 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124334
SMART Domains Protein: ENSMUSP00000114895
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 9e-3 SMART
PDB:2KP7|A 11 90 9e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 3e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126471
SMART Domains Protein: ENSMUSP00000121435
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 11 72 8e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133436
SMART Domains Protein: ENSMUSP00000118580
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 2 55 5e-30 PDB
low complexity region 57 72 N/A INTRINSIC
PDB:2MC3|A 86 194 8e-50 PDB
ERCC4 235 337 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209469
AA Change: S41R

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can polymerize and depolymerize F-actin and G-actin in a pH-dependent manner. Increased phosphorylation of this protein by LIM kinase aids in Rho-induced reorganization of the actin cytoskeleton. Cofilin is a widely distributed intracellular actin-modulating protein that binds and depolymerizes filamentous F-actin and inhibits the polymerization of monomeric G-actin in a pH-dependent manner. It is involved in the translocation of actin-cofilin complex from cytoplasm to nucleus.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice display embryonic lethality with impaired neural crest cell migration, an open neural tube, and abnormal somite and eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,293,718 probably benign Het
5031439G07Rik A C 15: 84,949,597 Y419* probably null Het
Abca2 T A 2: 25,444,139 F1809L probably damaging Het
Ache C T 5: 137,291,678 T423I probably benign Het
Acvrl1 A G 15: 101,138,345 T395A probably damaging Het
Ap3b2 A G 7: 81,477,993 I145T probably damaging Het
Arhgef4 A C 1: 34,722,452 Q263P unknown Het
Asgr2 C T 11: 70,096,810 L45F probably damaging Het
Baiap2l1 T A 5: 144,285,579 Y122F possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Car8 A T 4: 8,185,650 probably null Het
Carns1 T C 19: 4,170,082 T385A probably benign Het
Ccdc47 T C 11: 106,202,737 T41A probably benign Het
Ccne1 A T 7: 38,098,573 probably benign Het
Cdh4 C T 2: 179,797,504 T148I probably benign Het
Cep85 C T 4: 134,152,261 R392Q probably damaging Het
Ces1h T C 8: 93,353,495 T464A unknown Het
Crnn T C 3: 93,148,135 V76A probably damaging Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Dgkh A T 14: 78,627,742 C53* probably null Het
Dhx34 G T 7: 16,215,330 A391E possibly damaging Het
Dlx1 C A 2: 71,532,353 N201K probably benign Het
Dnah6 T C 6: 73,021,178 E4087G probably benign Het
Dock6 T C 9: 21,845,550 Y134C probably damaging Het
Duox2 A G 2: 122,291,227 V662A possibly damaging Het
Dusp12 A G 1: 170,880,961 F12L probably damaging Het
Eppk1 T C 15: 76,111,037 E548G probably benign Het
Foxj2 A G 6: 122,828,444 I92V probably damaging Het
Foxj2 A G 6: 122,842,839 D562G probably benign Het
Gm17728 A G 17: 9,422,159 R34G probably damaging Het
Gpc6 T C 14: 117,624,548 I292T probably damaging Het
Gpr15 T A 16: 58,718,185 K180N probably benign Het
Gtf2ird1 G T 5: 134,383,922 probably benign Het
Hist1h2ah A G 13: 22,035,549 S2P probably benign Het
Hps3 T A 3: 20,022,820 T393S probably damaging Het
Hspa1a A T 17: 34,970,291 probably null Het
Hydin A G 8: 110,531,072 E2378G possibly damaging Het
Ighv1-18 A G 12: 114,682,678 L102P probably damaging Het
Itga5 T A 15: 103,350,226 N814I probably benign Het
Kcnb2 T C 1: 15,710,256 S451P probably damaging Het
Klhl32 T G 4: 24,709,030 I112L probably damaging Het
Knstrn T G 2: 118,834,094 I47R possibly damaging Het
Med23 T A 10: 24,895,824 S581T possibly damaging Het
Mgat5 C T 1: 127,390,851 T361I probably damaging Het
Nipal3 A G 4: 135,479,547 V112A probably damaging Het
Olfr1287 T C 2: 111,449,352 F71L probably benign Het
Olfr1359 A G 13: 21,703,073 E24G probably benign Het
Olfr713 T A 7: 107,036,749 V198D possibly damaging Het
Olfr996 A G 2: 85,579,481 M81V probably benign Het
Paxip1 G A 5: 27,765,768 Q528* probably null Het
Proser2 T C 2: 6,113,990 D14G probably damaging Het
Rp1 T G 1: 4,345,655 I1745L probably benign Het
Rxfp2 G T 5: 150,048,848 probably null Het
Slc45a1 T C 4: 150,638,594 S278G possibly damaging Het
Smurf1 A G 5: 144,886,369 I455T possibly damaging Het
Speg T C 1: 75,430,913 L3188P probably damaging Het
Tcaf3 G T 6: 42,597,125 A51D probably damaging Het
Tecrl T C 5: 83,354,921 N12S possibly damaging Het
Tmem17 T A 11: 22,518,508 I149N possibly damaging Het
Tmem171 A G 13: 98,692,468 V58A possibly damaging Het
Ttn A G 2: 76,861,177 probably benign Het
Ubqln5 A G 7: 104,128,601 S339P probably benign Het
Vmn1r16 T A 6: 57,323,488 I50L probably benign Het
Vmn2r103 A T 17: 19,793,477 Y177F probably benign Het
Zfp28 C A 7: 6,394,693 T709K probably damaging Het
Zfp958 A G 8: 4,626,170 N46S probably benign Het
Zyx T A 6: 42,350,357 V30E unknown Het
Other mutations in Cfl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Cfl1 APN 19 5493681 utr 3 prime probably benign
IGL02903:Cfl1 APN 19 5492800 missense probably benign 0.03
R1657:Cfl1 UTSW 19 5493555 missense probably damaging 0.99
R4041:Cfl1 UTSW 19 5492528 missense probably benign 0.17
R5193:Cfl1 UTSW 19 5492552 missense probably damaging 1.00
R5449:Cfl1 UTSW 19 5493493 makesense probably null
R7287:Cfl1 UTSW 19 5492534 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CTCTGACTGAGGTTTCCTGTAAC -3'
(R):5'- ACGGAGCTCACCAGAAGATG -3'

Sequencing Primer
(F):5'- GACTGAGGTTTCCTGTAACTGCAAAG -3'
(R):5'- GATGAACACCAGGTCCTCCTTC -3'
Posted On2018-11-28