Incidental Mutation 'R6982:Myo3b'
ID542710
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6982 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70426065 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1248 (E1248D)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: E1276D

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: E1276D

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: E1248D

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: E1248D

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.0575 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Adamtsl3 C A 7: 82,515,063 P362H probably damaging Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
Bmp8a A G 4: 123,325,141 L158P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Clybl G A 14: 122,401,947 G308R probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Kdm4a A T 4: 118,153,439 probably null Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Man1a T C 10: 54,074,723 E101G possibly damaging Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Olfr951 T C 9: 39,394,322 I174T probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spata21 A T 4: 141,096,873 N149I possibly damaging Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Spink5 T C 18: 44,010,042 probably null Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tcf3 A T 10: 80,417,550 F215I probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCAGGATGTCTGCCTTCAC -3'
(R):5'- ACTAGTGTCAATAGCGTGGTAC -3'

Sequencing Primer
(F):5'- CTGCCTTCACGGTGAATAATTG -3'
(R):5'- CAATAGCGTGGTACTATCCGG -3'
Posted On2018-11-28