Incidental Mutation 'R6982:Bmp8a'
ID542720
Institutional Source Beutler Lab
Gene Symbol Bmp8a
Ensembl Gene ENSMUSG00000032726
Gene Namebone morphogenetic protein 8a
Synonymsosteogenic protein 2, OP2, Bmp7r1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R6982 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location123312645-123343252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123325141 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 158 (L158P)
Ref Sequence ENSEMBL: ENSMUSP00000099701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040496] [ENSMUST00000102640] [ENSMUST00000102641]
Predicted Effect probably damaging
Transcript: ENSMUST00000040496
AA Change: L158P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037779
Gene: ENSMUSG00000032726
AA Change: L158P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 27 248 3.1e-67 PFAM
low complexity region 250 271 N/A INTRINSIC
TGFB 298 412 2.18e-60 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102640
SMART Domains Protein: ENSMUSP00000099700
Gene: ENSMUSG00000076436

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
CoA_trans 43 272 2.17e-79 SMART
CoA_trans 301 499 5.07e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102641
AA Change: L158P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099701
Gene: ENSMUSG00000032726
AA Change: L158P

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 11 248 2e-57 PFAM
low complexity region 250 271 N/A INTRINSIC
TGFB 298 399 2e-68 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in development of the reproductive system. Mice lacking a functional copy of this gene exhibit degeneration of germ cells and the epididymal epithelium. This gene may have arose from a gene duplication event and its gene duplicate is also present on chromosome 4. [provided by RefSeq, Jul 2016]
PHENOTYPE: About half of the males homozygous for targeted mutations of this gene show spermatogenesis defects and germ cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Adamtsl3 C A 7: 82,515,063 P362H probably damaging Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Clybl G A 14: 122,401,947 G308R probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Kdm4a A T 4: 118,153,439 probably null Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Man1a T C 10: 54,074,723 E101G possibly damaging Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Myo3b A T 2: 70,426,065 E1248D probably benign Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Olfr951 T C 9: 39,394,322 I174T probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spata21 A T 4: 141,096,873 N149I possibly damaging Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Spink5 T C 18: 44,010,042 probably null Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tcf3 A T 10: 80,417,550 F215I probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in Bmp8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Bmp8a APN 4 123313301 missense probably damaging 1.00
IGL01816:Bmp8a APN 4 123316397 missense probably damaging 1.00
IGL02423:Bmp8a APN 4 123316427 missense possibly damaging 0.75
leanmean UTSW 4 123313301 missense probably damaging 1.00
R0437:Bmp8a UTSW 4 123316897 missense probably benign 0.28
R0540:Bmp8a UTSW 4 123315930 missense probably damaging 1.00
R1443:Bmp8a UTSW 4 123316965 missense possibly damaging 0.89
R1791:Bmp8a UTSW 4 123324585 missense possibly damaging 0.91
R1832:Bmp8a UTSW 4 123325092 splice site probably benign
R2215:Bmp8a UTSW 4 123325118 missense probably benign 0.03
R4502:Bmp8a UTSW 4 123342399 missense probably damaging 1.00
R4803:Bmp8a UTSW 4 123324569 missense possibly damaging 0.94
R5179:Bmp8a UTSW 4 123313301 missense probably damaging 1.00
R5350:Bmp8a UTSW 4 123313295 missense probably damaging 1.00
R6166:Bmp8a UTSW 4 123324678 missense probably benign 0.03
R6853:Bmp8a UTSW 4 123342683 missense unknown
R7304:Bmp8a UTSW 4 123342389 missense probably benign 0.44
R8266:Bmp8a UTSW 4 123315833 missense probably benign 0.20
R8377:Bmp8a UTSW 4 123342689 missense unknown
R8396:Bmp8a UTSW 4 123325159 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCCAAACCCCTTTCTCATG -3'
(R):5'- GCCTGTGTGTAGAGAAAGCATG -3'

Sequencing Primer
(F):5'- TCATGTCTGAGGCCCCTC -3'
(R):5'- GGTCCTACTCTGAGCACAAG -3'
Posted On2018-11-28