Incidental Mutation 'R6982:C1ra'
ID542727
Institutional Source Beutler Lab
Gene Symbol C1ra
Ensembl Gene ENSMUSG00000055172
Gene Namecomplement component 1, r subcomponent A
SynonymsmC1rA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6982 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124512405-124523443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124517725 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 316 (E316K)
Ref Sequence ENSEMBL: ENSMUSP00000063707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068593]
Predicted Effect probably benign
Transcript: ENSMUST00000068593
AA Change: E316K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172
AA Change: E316K

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Adamtsl3 C A 7: 82,515,063 P362H probably damaging Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
Bmp8a A G 4: 123,325,141 L158P probably damaging Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Clybl G A 14: 122,401,947 G308R probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Kdm4a A T 4: 118,153,439 probably null Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Man1a T C 10: 54,074,723 E101G possibly damaging Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Myo3b A T 2: 70,426,065 E1248D probably benign Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Olfr951 T C 9: 39,394,322 I174T probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spata21 A T 4: 141,096,873 N149I possibly damaging Het
Spink5 T C 18: 44,010,042 probably null Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tcf3 A T 10: 80,417,550 F215I probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in C1ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:C1ra APN 6 124522291 missense probably benign 0.00
IGL03079:C1ra APN 6 124519835 missense probably damaging 1.00
IGL03151:C1ra APN 6 124519771 missense probably benign 0.09
mueller-eberhardt UTSW 6 124512801 critical splice donor site probably null
pillemer UTSW 6 124516724 missense probably damaging 1.00
R0331:C1ra UTSW 6 124519435 splice site probably null
R0457:C1ra UTSW 6 124522753 missense probably benign
R0472:C1ra UTSW 6 124517444 missense possibly damaging 0.95
R0570:C1ra UTSW 6 124513705 missense probably benign 0.00
R0634:C1ra UTSW 6 124517505 missense possibly damaging 0.49
R0661:C1ra UTSW 6 124522377 missense probably benign
R1451:C1ra UTSW 6 124521641 missense probably benign 0.04
R1640:C1ra UTSW 6 124522274 missense probably benign 0.17
R1698:C1ra UTSW 6 124522766 missense probably benign 0.05
R4020:C1ra UTSW 6 124519777 missense probably benign 0.01
R4801:C1ra UTSW 6 124513768 missense probably benign 0.00
R4802:C1ra UTSW 6 124513768 missense probably benign 0.00
R4909:C1ra UTSW 6 124522334 missense probably damaging 1.00
R5086:C1ra UTSW 6 124519729 missense probably damaging 1.00
R5108:C1ra UTSW 6 124522922 missense probably damaging 1.00
R5372:C1ra UTSW 6 124521625 missense probably damaging 1.00
R5421:C1ra UTSW 6 124522790 missense probably benign 0.36
R5635:C1ra UTSW 6 124516724 missense probably damaging 1.00
R6438:C1ra UTSW 6 124513777 missense possibly damaging 0.54
R6518:C1ra UTSW 6 124521575 intron probably null
R6738:C1ra UTSW 6 124517759 missense probably damaging 1.00
R6804:C1ra UTSW 6 124517725 missense probably benign
R6805:C1ra UTSW 6 124517725 missense probably benign
R6939:C1ra UTSW 6 124512801 critical splice donor site probably null
R6981:C1ra UTSW 6 124517725 missense probably benign
R7056:C1ra UTSW 6 124517725 missense probably benign
R7057:C1ra UTSW 6 124517725 missense probably benign
R7094:C1ra UTSW 6 124517725 missense probably benign
R7468:C1ra UTSW 6 124522444 nonsense probably null
R7476:C1ra UTSW 6 124522699 missense probably damaging 1.00
R7478:C1ra UTSW 6 124517725 missense probably benign
R7479:C1ra UTSW 6 124517725 missense probably benign
R7481:C1ra UTSW 6 124517725 missense probably benign
R7512:C1ra UTSW 6 124517725 missense probably benign
R7725:C1ra UTSW 6 124517725 missense probably benign
R7728:C1ra UTSW 6 124517725 missense probably benign
R7730:C1ra UTSW 6 124517725 missense probably benign
R7818:C1ra UTSW 6 124517725 missense probably benign
R7819:C1ra UTSW 6 124517725 missense probably benign
R7835:C1ra UTSW 6 124517725 missense probably benign
R7854:C1ra UTSW 6 124517741 missense probably benign 0.00
R7876:C1ra UTSW 6 124517725 missense probably benign
R7877:C1ra UTSW 6 124517725 missense probably benign
R7881:C1ra UTSW 6 124517725 missense probably benign
R7883:C1ra UTSW 6 124517725 missense probably benign
R7892:C1ra UTSW 6 124519415 missense probably benign 0.07
R7899:C1ra UTSW 6 124517725 missense probably benign
R7901:C1ra UTSW 6 124517725 missense probably benign
R7902:C1ra UTSW 6 124517725 missense probably benign
R7903:C1ra UTSW 6 124517725 missense probably benign
R7947:C1ra UTSW 6 124517379 missense probably benign 0.02
R8087:C1ra UTSW 6 124513872 missense probably damaging 1.00
R8098:C1ra UTSW 6 124517725 missense probably benign
R8099:C1ra UTSW 6 124517725 missense probably benign
R8271:C1ra UTSW 6 124522651 missense probably damaging 1.00
R8300:C1ra UTSW 6 124521638 missense probably benign 0.04
X0062:C1ra UTSW 6 124522439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGGCTTCCTGGGAAAC -3'
(R):5'- GGCAGACAGATTGATTCTTCCAGC -3'

Sequencing Primer
(F):5'- ACTTGTGTTGAACATGGATGAGACC -3'
(R):5'- AGATTGATTCTTCCAGCCCCAAC -3'
Posted On2018-11-28