Incidental Mutation 'R6982:Adamtsl3'
ID542732
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6982 (G1)
Quality Score157.009
Status Validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 82515063 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 362 (P362H)
Ref Sequence ENSEMBL: ENSMUSP00000133637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect probably damaging
Transcript: ENSMUST00000173287
AA Change: P362H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: P362H

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173828
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
MGI Phenotype Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
Bmp8a A G 4: 123,325,141 L158P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Clybl G A 14: 122,401,947 G308R probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Kdm4a A T 4: 118,153,439 probably null Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Man1a T C 10: 54,074,723 E101G possibly damaging Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Myo3b A T 2: 70,426,065 E1248D probably benign Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Olfr951 T C 9: 39,394,322 I174T probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spata21 A T 4: 141,096,873 N149I possibly damaging Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Spink5 T C 18: 44,010,042 probably null Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tcf3 A T 10: 80,417,550 F215I probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 intron probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
R7784:Adamtsl3 UTSW 7 82573989 missense probably damaging 1.00
R7858:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
R7941:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
RF005:Adamtsl3 UTSW 7 82612395 missense
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGGCAAGTCTGAGTGAC -3'
(R):5'- GCACTTGGATTATACTTGACCCC -3'

Sequencing Primer
(F):5'- GAGTGACAGGCTATCCTATCTAAAGC -3'
(R):5'- TTGGATTATACTTGACCCCAAACC -3'
Posted On2018-11-28