Incidental Mutation 'R6982:Olfr951'
ID542737
Institutional Source Beutler Lab
Gene Symbol Olfr951
Ensembl Gene ENSMUSG00000094269
Gene Nameolfactory receptor 951
SynonymsMOR171-49, MOR171-33P, GA_x6K02T2PVTD-33090395-33091330
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6982 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39387410-39395633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39394322 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 174 (I174T)
Ref Sequence ENSEMBL: ENSMUSP00000150976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078531] [ENSMUST00000216107]
Predicted Effect probably damaging
Transcript: ENSMUST00000078531
AA Change: I177T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077615
Gene: ENSMUSG00000094269
AA Change: I177T

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.5e-52 PFAM
Pfam:7tm_1 44 293 5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216107
AA Change: I174T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Adamtsl3 C A 7: 82,515,063 P362H probably damaging Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
Bmp8a A G 4: 123,325,141 L158P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Clybl G A 14: 122,401,947 G308R probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Kdm4a A T 4: 118,153,439 probably null Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Man1a T C 10: 54,074,723 E101G possibly damaging Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Myo3b A T 2: 70,426,065 E1248D probably benign Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spata21 A T 4: 141,096,873 N149I possibly damaging Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Spink5 T C 18: 44,010,042 probably null Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tcf3 A T 10: 80,417,550 F215I probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in Olfr951
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr951 APN 9 39393818 missense probably benign 0.01
IGL01650:Olfr951 APN 9 39393956 missense probably damaging 0.99
IGL02134:Olfr951 APN 9 39394534 missense probably damaging 0.99
IGL03113:Olfr951 APN 9 39394685 missense probably damaging 1.00
R0127:Olfr951 UTSW 9 39393942 missense probably benign 0.16
R1730:Olfr951 UTSW 9 39394222 missense probably benign 0.01
R1783:Olfr951 UTSW 9 39394222 missense probably benign 0.01
R1924:Olfr951 UTSW 9 39393867 missense possibly damaging 0.93
R3785:Olfr951 UTSW 9 39394382 missense probably benign 0.07
R3787:Olfr951 UTSW 9 39394382 missense probably benign 0.07
R4607:Olfr951 UTSW 9 39394735 makesense probably null
R4803:Olfr951 UTSW 9 39394636 missense probably benign 0.26
R5314:Olfr951 UTSW 9 39394489 missense probably damaging 1.00
R5338:Olfr951 UTSW 9 39394075 missense probably damaging 1.00
R5360:Olfr951 UTSW 9 39394402 missense probably benign 0.00
R5468:Olfr951 UTSW 9 39393961 missense probably benign 0.33
R6590:Olfr951 UTSW 9 39394549 missense probably benign 0.00
R6690:Olfr951 UTSW 9 39394549 missense probably benign 0.00
R6925:Olfr951 UTSW 9 39393860 missense probably benign 0.32
R6925:Olfr951 UTSW 9 39393861 missense probably benign 0.01
R7662:Olfr951 UTSW 9 39394093 missense probably benign 0.01
R8074:Olfr951 UTSW 9 39393946 missense probably damaging 1.00
R8389:Olfr951 UTSW 9 39394616 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGGCACTGCAGAGAGC -3'
(R):5'- TGCTGAAGGCTTTGGACCTG -3'

Sequencing Primer
(F):5'- TTGGCACTGCAGAGAGCTACAC -3'
(R):5'- TGCCCTCCCTAGAGTGAATG -3'
Posted On2018-11-28