Incidental Mutation 'R6982:Man1a'
ID542741
Institutional Source Beutler Lab
Gene Symbol Man1a
Ensembl Gene ENSMUSG00000003746
Gene Namemannosidase 1, alpha
Synonymsmannosyl-oligosaccharide alpha-1,2-mannosidase, PCR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R6982 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location53904785-54076609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54074723 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 101 (E101G)
Ref Sequence ENSEMBL: ENSMUSP00000151328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003843] [ENSMUST00000105470] [ENSMUST00000218317] [ENSMUST00000220088]
Predicted Effect probably benign
Transcript: ENSMUST00000003843
AA Change: E101G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000003843
Gene: ENSMUSG00000003746
AA Change: E101G

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.6e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105470
AA Change: E101G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101110
Gene: ENSMUSG00000003746
AA Change: E101G

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
coiled coil region 116 151 N/A INTRINSIC
Pfam:Glyco_hydro_47 204 642 4.5e-153 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218317
AA Change: E101G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000220088
AA Change: E192G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class I mammalian Golgi 1,2-mannosidase which is a type II transmembrane protein. This protein catalyzes the hydrolysis of three terminal mannose residues from peptide-bound Man(9)-GlcNAc(2) oligosaccharides and belongs to family 47 of glycosyl hydrolases. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Adamtsl3 C A 7: 82,515,063 P362H probably damaging Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
Bmp8a A G 4: 123,325,141 L158P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Clybl G A 14: 122,401,947 G308R probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Kdm4a A T 4: 118,153,439 probably null Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Myo3b A T 2: 70,426,065 E1248D probably benign Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Olfr951 T C 9: 39,394,322 I174T probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spata21 A T 4: 141,096,873 N149I possibly damaging Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Spink5 T C 18: 44,010,042 probably null Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tcf3 A T 10: 80,417,550 F215I probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in Man1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Man1a APN 10 53977013 splice site probably benign
IGL01146:Man1a APN 10 53907519 missense possibly damaging 0.90
IGL01412:Man1a APN 10 54074714 missense probably benign 0.00
IGL02009:Man1a APN 10 53925525 missense probably damaging 1.00
IGL02026:Man1a APN 10 54014473 missense probably damaging 1.00
IGL02745:Man1a APN 10 53977110 missense probably damaging 0.99
IGL02851:Man1a APN 10 53919244 missense probably damaging 1.00
IGL02929:Man1a APN 10 53925435 missense probably benign 0.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0046:Man1a UTSW 10 53919187 missense probably damaging 1.00
R0101:Man1a UTSW 10 54075024 start codon destroyed probably null
R0200:Man1a UTSW 10 54074498 missense probably damaging 0.96
R0463:Man1a UTSW 10 54074498 missense probably damaging 0.96
R0947:Man1a UTSW 10 53933523 nonsense probably null
R1219:Man1a UTSW 10 53919153 splice site probably benign
R1876:Man1a UTSW 10 53919172 missense probably damaging 1.00
R2142:Man1a UTSW 10 53934998 missense probably damaging 1.00
R2219:Man1a UTSW 10 53977049 missense probably damaging 0.99
R3117:Man1a UTSW 10 54030794 missense probably damaging 0.97
R3119:Man1a UTSW 10 54030794 missense probably damaging 0.97
R4727:Man1a UTSW 10 53907572 splice site probably null
R4942:Man1a UTSW 10 53933490 critical splice donor site probably null
R5493:Man1a UTSW 10 54074480 missense probably benign 0.25
R5921:Man1a UTSW 10 53907510 missense probably damaging 0.97
R5965:Man1a UTSW 10 53933490 critical splice donor site probably benign
R6084:Man1a UTSW 10 53919211 missense probably damaging 1.00
R6199:Man1a UTSW 10 54014456 missense possibly damaging 0.70
R6362:Man1a UTSW 10 54074795 missense probably benign 0.25
R6543:Man1a UTSW 10 53934981 nonsense probably null
R6711:Man1a UTSW 10 53933492 missense probably benign 0.00
R7061:Man1a UTSW 10 53920235 missense probably damaging 1.00
R7063:Man1a UTSW 10 54030744 missense probably damaging 1.00
R7220:Man1a UTSW 10 53920235 missense possibly damaging 0.95
R7361:Man1a UTSW 10 53908009 missense probably damaging 1.00
R7392:Man1a UTSW 10 53919187 missense probably damaging 1.00
R7566:Man1a UTSW 10 53919234 missense possibly damaging 0.93
R7864:Man1a UTSW 10 54030747 missense possibly damaging 0.88
R8338:Man1a UTSW 10 53925547 critical splice acceptor site probably null
Z1176:Man1a UTSW 10 53919315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGATCCTTGTCACGCAG -3'
(R):5'- TGTTGCCGCTCTTCAGTAGC -3'

Sequencing Primer
(F):5'- TTGTCACGCAGCTGGTC -3'
(R):5'- TCCGCCTCACCGAGAAGTTC -3'
Posted On2018-11-28