Incidental Mutation 'R6982:Tcf3'
ID542742
Institutional Source Beutler Lab
Gene Symbol Tcf3
Ensembl Gene ENSMUSG00000020167
Gene Nametranscription factor 3
SynonymsA1, ALF2, bHLHb21, E12, E2A, E47, Pan1, Pan2, Tcfe2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R6982 (G1)
Quality Score197.009
Status Validated
Chromosome10
Chromosomal Location80409514-80433647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80417550 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 215 (F215I)
Ref Sequence ENSEMBL: ENSMUSP00000100982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020377] [ENSMUST00000020379] [ENSMUST00000105339] [ENSMUST00000105340] [ENSMUST00000105341] [ENSMUST00000105342] [ENSMUST00000105343] [ENSMUST00000105344] [ENSMUST00000105345] [ENSMUST00000105346] [ENSMUST00000156244]
PDB Structure
Crystal Structure of the basic-helix-loop-helix domains of the heterodimer E47/NeuroD1 bound to DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000020377
AA Change: F216I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020377
Gene: ENSMUSG00000020167
AA Change: F216I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
HLH 553 606 2.66e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000020379
AA Change: F215I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020379
Gene: ENSMUSG00000020167
AA Change: F215I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105339
AA Change: F215I

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100976
Gene: ENSMUSG00000020167
AA Change: F215I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
HLH 549 602 2.66e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105340
AA Change: F215I

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100977
Gene: ENSMUSG00000020167
AA Change: F215I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105341
AA Change: F215I

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100978
Gene: ENSMUSG00000020167
AA Change: F215I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
HLH 546 599 8.79e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105342
AA Change: F216I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100979
Gene: ENSMUSG00000020167
AA Change: F216I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
HLH 554 607 2.66e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105343
AA Change: F216I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100980
Gene: ENSMUSG00000020167
AA Change: F216I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105344
AA Change: F216I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100981
Gene: ENSMUSG00000020167
AA Change: F216I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
HLH 551 604 8.79e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105345
AA Change: F215I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100982
Gene: ENSMUSG00000020167
AA Change: F215I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105346
AA Change: F215I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100983
Gene: ENSMUSG00000020167
AA Change: F215I

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
HLH 552 605 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156244
SMART Domains Protein: ENSMUSP00000120303
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121172
Gene: ENSMUSG00000020167
AA Change: F207I

DomainStartEndE-ValueType
low complexity region 47 65 N/A INTRINSIC
low complexity region 117 140 N/A INTRINSIC
low complexity region 234 257 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
low complexity region 451 469 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
HLH 539 592 8.79e-11 SMART
Meta Mutation Damage Score 0.3597 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development. Deletion of this gene or diminished activity of the encoded protein may play a role in lymphoid malignancies. This gene is also involved in several chromosomal translocations that are associated with lymphoid malignancies including pre-B-cell acute lymphoblastic leukemia (t(1;19), with PBX1), childhood leukemia (t(19;19), with TFPT) and acute leukemia (t(12;19), with ZNF384). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations are devoid of mature B cells, have a partial early block in T-lymphocyte development, and show high postnatal mortality. Many survivors develop T-cell lymphomas between 3 and 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Adamtsl3 C A 7: 82,515,063 P362H probably damaging Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
Bmp8a A G 4: 123,325,141 L158P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Clybl G A 14: 122,401,947 G308R probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Kdm4a A T 4: 118,153,439 probably null Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Man1a T C 10: 54,074,723 E101G possibly damaging Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Myo3b A T 2: 70,426,065 E1248D probably benign Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Olfr951 T C 9: 39,394,322 I174T probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spata21 A T 4: 141,096,873 N149I possibly damaging Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Spink5 T C 18: 44,010,042 probably null Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in Tcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Tcf3 APN 10 80413209 missense probably benign 0.30
IGL02676:Tcf3 APN 10 80421091 missense probably damaging 1.00
IGL03066:Tcf3 APN 10 80413045 missense probably damaging 0.97
R0165:Tcf3 UTSW 10 80412997 missense probably damaging 1.00
R0401:Tcf3 UTSW 10 80421158 missense probably damaging 0.99
R0624:Tcf3 UTSW 10 80413334 missense probably damaging 1.00
R2114:Tcf3 UTSW 10 80410206 missense probably damaging 1.00
R5034:Tcf3 UTSW 10 80417543 missense possibly damaging 0.46
R5144:Tcf3 UTSW 10 80415237 missense probably damaging 0.98
R5347:Tcf3 UTSW 10 80410211 missense probably damaging 1.00
R5418:Tcf3 UTSW 10 80427683 missense probably damaging 1.00
R5771:Tcf3 UTSW 10 80421616 intron probably benign
R5786:Tcf3 UTSW 10 80419499 missense probably benign 0.06
R5941:Tcf3 UTSW 10 80413044 missense probably benign 0.06
R6857:Tcf3 UTSW 10 80416899 intron probably null
R7178:Tcf3 UTSW 10 80421599 missense unknown
R7840:Tcf3 UTSW 10 80410467 missense possibly damaging 0.87
R8336:Tcf3 UTSW 10 80421166 missense probably benign
X0022:Tcf3 UTSW 10 80417458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCTACCATGCGATCCTG -3'
(R):5'- TTAGGTTTCTAGGACCTCCAGGG -3'

Sequencing Primer
(F):5'- ATGCGATCCTGCTGCTG -3'
(R):5'- GCCTAGGCATGGAGCTG -3'
Posted On2018-11-28