Incidental Mutation 'R6982:Clybl'
ID542749
Institutional Source Beutler Lab
Gene Symbol Clybl
Ensembl Gene ENSMUSG00000025545
Gene Namecitrate lyase beta like
SynonymsClb, 2310014M14Rik, 0610033J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6982 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location122181704-122402234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122401947 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 308 (G308R)
Ref Sequence ENSEMBL: ENSMUSP00000026625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026625]
Predicted Effect probably damaging
Transcript: ENSMUST00000026625
AA Change: G308R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026625
Gene: ENSMUSG00000025545
AA Change: G308R

DomainStartEndE-ValueType
Pfam:HpcH_HpaI 44 272 1.4e-51 PFAM
Pfam:C-C_Bond_Lyase 218 334 2.9e-10 PFAM
Meta Mutation Damage Score 0.8656 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,544 Y7* probably null Het
Adamts16 T A 13: 70,768,520 probably null Het
Adamtsl3 C A 7: 82,515,063 P362H probably damaging Het
Ambra1 G A 2: 91,917,473 V1065I probably damaging Het
Ankrd66 T C 17: 43,539,035 T79A probably damaging Het
Ano2 G A 6: 125,992,893 R724H probably benign Het
Bmp8a A G 4: 123,325,141 L158P probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cilp T C 9: 65,279,805 Y1061H probably damaging Het
Cntnap5c C T 17: 58,092,252 P367S possibly damaging Het
Col20a1 T C 2: 180,996,706 V371A probably benign Het
Col24a1 G T 3: 145,315,046 G393* probably null Het
Dnah12 A G 14: 26,799,076 probably null Het
Dnah8 T A 17: 30,767,925 S3183T probably benign Het
Dph2 A T 4: 117,889,796 I435N probably benign Het
Fam3c G T 6: 22,322,301 A107D probably damaging Het
Fezf2 G T 14: 12,343,645 Q367K probably damaging Het
Gbp2 A G 3: 142,630,085 D182G probably damaging Het
Gpr162 T A 6: 124,860,956 I244F probably damaging Het
Jakmip1 A T 5: 37,124,941 N159I probably damaging Het
Kdm4a A T 4: 118,153,439 probably null Het
Klf5 A G 14: 99,313,235 H416R probably damaging Het
Lrrc63 A G 14: 75,084,771 V631A probably benign Het
Man1a T C 10: 54,074,723 E101G possibly damaging Het
Msantd4 T A 9: 4,384,061 N127K possibly damaging Het
Myo3b A T 2: 70,426,065 E1248D probably benign Het
Ncapd2 A T 6: 125,176,736 I672N probably damaging Het
Nfic T C 10: 81,420,800 probably null Het
Nr1h3 A G 2: 91,190,759 S228P probably damaging Het
Olfr951 T C 9: 39,394,322 I174T probably damaging Het
Pccb A T 9: 101,023,296 probably null Het
Pcmtd1 T G 1: 7,147,682 V118G probably damaging Het
Pkhd1l1 A T 15: 44,566,268 N3294I probably damaging Het
Plscr4 A G 9: 92,482,743 T74A probably benign Het
Rasa2 A T 9: 96,560,750 I540N probably damaging Het
Serpina3j C A 12: 104,317,297 T218K probably benign Het
Slc16a4 A G 3: 107,299,273 D173G probably benign Het
Slc19a2 T C 1: 164,256,859 L106P possibly damaging Het
Slc22a19 C T 19: 7,682,969 V359M probably benign Het
Slc22a7 T A 17: 46,434,637 M323L probably benign Het
Spata21 A T 4: 141,096,873 N149I possibly damaging Het
Spink5 G A 18: 43,977,725 G121D probably damaging Het
Spink5 T C 18: 44,010,042 probably null Het
Ssbp4 T C 8: 70,608,165 S6G possibly damaging Het
Sytl2 T C 7: 90,396,564 S641P probably damaging Het
Tcf3 A T 10: 80,417,550 F215I probably damaging Het
Tmem150c C A 5: 100,092,821 D61Y probably benign Het
Ttc7 T A 17: 87,307,009 F201I probably damaging Het
Tyw3 T C 3: 154,580,230 I208V probably benign Het
Vmn1r202 T C 13: 22,501,747 T167A probably benign Het
Vmn1r83 A T 7: 12,321,836 L98Q probably damaging Het
Vmn2r95 T C 17: 18,452,061 Y687H probably damaging Het
Wdr59 A T 8: 111,460,813 F783L probably benign Het
Zfhx4 A G 3: 5,403,830 Y3016C probably damaging Het
Zfp518b T C 5: 38,672,905 T586A probably benign Het
Other mutations in Clybl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Clybl APN 14 122379198 splice site probably benign
IGL01380:Clybl APN 14 122379349 missense probably benign 0.04
IGL01589:Clybl APN 14 122371422 missense probably damaging 1.00
IGL02043:Clybl APN 14 122379252 missense probably damaging 1.00
IGL03111:Clybl APN 14 122401983 missense probably damaging 1.00
IGL03328:Clybl APN 14 122401994 missense probably damaging 0.99
R2104:Clybl UTSW 14 122311306 missense probably damaging 1.00
R4869:Clybl UTSW 14 122384206 missense probably damaging 1.00
R5067:Clybl UTSW 14 122379289 missense possibly damaging 0.77
R5138:Clybl UTSW 14 122371304 missense possibly damaging 0.46
R5255:Clybl UTSW 14 122384279 missense probably benign 0.02
R5620:Clybl UTSW 14 122311343 missense probably damaging 0.97
R7162:Clybl UTSW 14 122371320 nonsense probably null
R8055:Clybl UTSW 14 122377861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTTACCATGTTTTGTGTCTGC -3'
(R):5'- TCCTGATCCAGCATGCTAGC -3'

Sequencing Primer
(F):5'- AAGCTGAAGGATTTTCCCCC -3'
(R):5'- TAGCAAGCTGCCCTGGGTAC -3'
Posted On2018-11-28