Incidental Mutation 'R6983:4930430A15Rik'
ID 542764
Institutional Source Beutler Lab
Gene Symbol 4930430A15Rik
Ensembl Gene ENSMUSG00000027157
Gene Name RIKEN cDNA 4930430A15 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6983 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111162061-111229602 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 111228250 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577] [ENSMUST00000099620] [ENSMUST00000216421] [ENSMUST00000217539]
AlphaFold Q05AC5
Predicted Effect probably null
Transcript: ENSMUST00000028577
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099620
SMART Domains Protein: ENSMUSP00000097215
Gene: ENSMUSG00000074966

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 9.8e-37 PFAM
Pfam:7tm_1 41 287 5.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216421
Predicted Effect probably benign
Transcript: ENSMUST00000217539
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik A G 1: 136,220,156 S353P possibly damaging Het
Abca15 T C 7: 120,354,463 V530A probably benign Het
Adgrg6 T C 10: 14,431,695 N816D probably damaging Het
Aebp2 T C 6: 140,637,663 F288L possibly damaging Het
Afdn T C 17: 13,881,321 S1024P probably damaging Het
Akap6 A C 12: 52,887,653 K643Q probably damaging Het
Atg2a A T 19: 6,260,040 D1751V probably damaging Het
Best2 T A 8: 85,009,776 I253F probably benign Het
Bmp1 G T 14: 70,508,207 P55T probably damaging Het
C1s1 C A 6: 124,540,896 V42F possibly damaging Het
Ccdc115 A G 1: 34,439,041 probably null Het
Cdc42bpg C T 19: 6,321,668 P1326S probably damaging Het
Cdhr3 G A 12: 33,042,380 T744I probably benign Het
Cit T G 5: 115,994,091 L1745R probably damaging Het
Commd6 A T 14: 101,637,052 S39T probably damaging Het
Crot T G 5: 8,978,280 Y223S probably benign Het
Crybg1 G T 10: 43,999,342 A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 E841K probably damaging Het
Dennd4c T C 4: 86,799,493 Y576H probably damaging Het
Diaph1 A T 18: 37,889,769 V749E probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
F5 A T 1: 164,194,129 D1391V probably damaging Het
Foxf2 T A 13: 31,627,197 M373K probably benign Het
Fstl1 A T 16: 37,831,618 E287D probably benign Het
Gltpd2 T C 11: 70,520,284 Y134H probably damaging Het
Hemgn T A 4: 46,395,997 H413L possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hykk T C 9: 54,946,509 S372P probably benign Het
Ints10 T C 8: 68,794,051 V11A probably damaging Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Lamtor2 G A 3: 88,552,839 Q9* probably null Het
Lonp2 T A 8: 86,624,248 V22E probably damaging Het
Mad1l1 T C 5: 140,193,984 E383G probably damaging Het
Man2b1 T A 8: 85,091,071 probably null Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Myo18a T A 11: 77,845,515 M1546K probably benign Het
Ntf3 T C 6: 126,101,845 T233A probably damaging Het
Olfr600 C T 7: 103,346,815 V38I probably benign Het
Omg T C 11: 79,501,938 S365G probably benign Het
Otol1 T A 3: 70,028,041 N455K probably damaging Het
Palm2 T A 4: 57,709,973 V306D probably damaging Het
Pde4dip A T 3: 97,718,236 Y1349N probably damaging Het
Pitpnm2 A G 5: 124,133,406 L368P probably damaging Het
Pnpla8 T A 12: 44,283,247 I194K possibly damaging Het
Podn T C 4: 108,024,273 probably null Het
Pramel6 A T 2: 87,509,579 E229V possibly damaging Het
Ptpro C T 6: 137,449,917 P262L probably damaging Het
Rnf122 A T 8: 31,118,460 T19S probably benign Het
Shank2 T A 7: 144,081,848 Y320N possibly damaging Het
Slc2a9 A C 5: 38,391,721 I243S probably damaging Het
Slc5a6 A T 5: 31,040,405 M130K probably benign Het
Stx5a A G 19: 8,755,169 probably benign Het
Tbr1 G T 2: 61,811,735 G185V probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tg A G 15: 66,693,358 D1183G probably benign Het
Thbs1 A T 2: 118,119,952 I689F probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trub2 A T 2: 29,787,784 probably benign Het
Ttn A G 2: 76,766,962 V19869A probably damaging Het
Tufm T C 7: 126,489,435 V303A possibly damaging Het
Vezf1 T C 11: 88,073,319 I99T possibly damaging Het
Vmn2r1 T C 3: 64,081,697 V19A probably benign Het
Xpc C T 6: 91,504,023 R289K probably damaging Het
Zfp811 T A 17: 32,797,432 K545* probably null Het
Zmiz2 G A 11: 6,402,413 D623N probably damaging Het
Other mutations in 4930430A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:4930430A15Rik APN 2 111220762 missense probably damaging 0.98
IGL01403:4930430A15Rik APN 2 111229170 unclassified probably benign
IGL01431:4930430A15Rik APN 2 111225395 unclassified probably benign
IGL01601:4930430A15Rik APN 2 111193478 missense unknown
IGL01649:4930430A15Rik APN 2 111214576 splice site probably benign
IGL02355:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02362:4930430A15Rik APN 2 111211651 splice site probably benign
IGL02485:4930430A15Rik APN 2 111228325 missense probably damaging 0.97
IGL02620:4930430A15Rik APN 2 111211625 missense probably benign 0.00
IGL03156:4930430A15Rik APN 2 111200412 missense possibly damaging 0.90
IGL02980:4930430A15Rik UTSW 2 111164473 missense unknown
R0577:4930430A15Rik UTSW 2 111194349 missense probably benign 0.27
R0638:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R0645:4930430A15Rik UTSW 2 111214583 critical splice donor site probably null
R0671:4930430A15Rik UTSW 2 111204137 missense possibly damaging 0.93
R0829:4930430A15Rik UTSW 2 111198105 missense possibly damaging 0.92
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1464:4930430A15Rik UTSW 2 111225403 critical splice donor site probably null
R1486:4930430A15Rik UTSW 2 111200358 missense possibly damaging 0.84
R1509:4930430A15Rik UTSW 2 111218627 missense probably benign
R1672:4930430A15Rik UTSW 2 111220774 missense probably benign 0.00
R2073:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2074:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2075:4930430A15Rik UTSW 2 111200418 missense probably damaging 0.96
R2899:4930430A15Rik UTSW 2 111220670 splice site probably benign
R2965:4930430A15Rik UTSW 2 111204019 missense possibly damaging 0.61
R3110:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R3112:4930430A15Rik UTSW 2 111228054 missense probably damaging 1.00
R4489:4930430A15Rik UTSW 2 111220702 missense probably benign 0.31
R4821:4930430A15Rik UTSW 2 111204145 critical splice acceptor site probably null
R4925:4930430A15Rik UTSW 2 111218616 missense probably benign 0.41
R5045:4930430A15Rik UTSW 2 111193459 missense unknown
R5057:4930430A15Rik UTSW 2 111225421 missense probably benign 0.12
R5128:4930430A15Rik UTSW 2 111164329 nonsense probably null
R5250:4930430A15Rik UTSW 2 111228077 missense possibly damaging 0.87
R5333:4930430A15Rik UTSW 2 111194337 missense possibly damaging 0.92
R5376:4930430A15Rik UTSW 2 111215599 missense probably benign 0.44
R5677:4930430A15Rik UTSW 2 111211565 missense probably benign
R5722:4930430A15Rik UTSW 2 111204123 missense probably benign
R5735:4930430A15Rik UTSW 2 111225492 nonsense probably null
R6170:4930430A15Rik UTSW 2 111227948 missense probably benign 0.03
R6366:4930430A15Rik UTSW 2 111169592 critical splice donor site probably null
R6496:4930430A15Rik UTSW 2 111164472 missense unknown
R6654:4930430A15Rik UTSW 2 111171884 missense unknown
R7371:4930430A15Rik UTSW 2 111193481 missense unknown
R7958:4930430A15Rik UTSW 2 111170325 missense unknown
R8421:4930430A15Rik UTSW 2 111218610 nonsense probably null
R8495:4930430A15Rik UTSW 2 111229410 start codon destroyed probably null 0.33
R8534:4930430A15Rik UTSW 2 111228035 missense possibly damaging 0.92
R8671:4930430A15Rik UTSW 2 111229532 unclassified probably benign
R8679:4930430A15Rik UTSW 2 111229222 missense possibly damaging 0.73
R8743:4930430A15Rik UTSW 2 111169672 missense unknown
R8983:4930430A15Rik UTSW 2 111200356 missense probably benign 0.00
R9213:4930430A15Rik UTSW 2 111190354 missense unknown
R9457:4930430A15Rik UTSW 2 111170286 missense unknown
R9723:4930430A15Rik UTSW 2 111228355 missense probably damaging 0.97
R9745:4930430A15Rik UTSW 2 111169663 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGTTTTGAACAGCCTAGGAGC -3'
(R):5'- GGTGGAAGAATCACCTAACATTC -3'

Sequencing Primer
(F):5'- GTTTTGAACAGCCTAGGAGCATACC -3'
(R):5'- TAGGACTGCCCTGCATTT -3'
Posted On 2018-11-28