Incidental Mutation 'R6983:Otol1'
ID542767
Institutional Source Beutler Lab
Gene Symbol Otol1
Ensembl Gene ENSMUSG00000027788
Gene Nameotolin 1
SynonymsGm414, LOC229389
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6983 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location70007613-70028708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70028041 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 455 (N455K)
Ref Sequence ENSEMBL: ENSMUSP00000057607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053013]
Predicted Effect probably damaging
Transcript: ENSMUST00000053013
AA Change: N455K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057607
Gene: ENSMUSG00000027788
AA Change: N455K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Collagen 116 175 8.8e-11 PFAM
internal_repeat_2 183 229 1.02e-7 PROSPERO
Pfam:Collagen 232 302 2.4e-9 PFAM
low complexity region 328 340 N/A INTRINSIC
C1Q 341 475 9.83e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,228,250 probably null Het
5730559C18Rik A G 1: 136,220,156 S353P possibly damaging Het
Abca15 T C 7: 120,354,463 V530A probably benign Het
Adgrg6 T C 10: 14,431,695 N816D probably damaging Het
Aebp2 T C 6: 140,637,663 F288L possibly damaging Het
Afdn T C 17: 13,881,321 S1024P probably damaging Het
Akap6 A C 12: 52,887,653 K643Q probably damaging Het
Atg2a A T 19: 6,260,040 D1751V probably damaging Het
Best2 T A 8: 85,009,776 I253F probably benign Het
Bmp1 G T 14: 70,508,207 P55T probably damaging Het
C1s1 C A 6: 124,540,896 V42F possibly damaging Het
Ccdc115 A G 1: 34,439,041 probably null Het
Cdc42bpg C T 19: 6,321,668 P1326S probably damaging Het
Cdhr3 G A 12: 33,042,380 T744I probably benign Het
Cit T G 5: 115,994,091 L1745R probably damaging Het
Commd6 A T 14: 101,637,052 S39T probably damaging Het
Crot T G 5: 8,978,280 Y223S probably benign Het
Crybg1 G T 10: 43,999,342 A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 E841K probably damaging Het
Dennd4c T C 4: 86,799,493 Y576H probably damaging Het
Diaph1 A T 18: 37,889,769 V749E probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
F5 A T 1: 164,194,129 D1391V probably damaging Het
Foxf2 T A 13: 31,627,197 M373K probably benign Het
Fstl1 A T 16: 37,831,618 E287D probably benign Het
Gltpd2 T C 11: 70,520,284 Y134H probably damaging Het
Hemgn T A 4: 46,395,997 H413L possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hykk T C 9: 54,946,509 S372P probably benign Het
Ints10 T C 8: 68,794,051 V11A probably damaging Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Lamtor2 G A 3: 88,552,839 Q9* probably null Het
Lonp2 T A 8: 86,624,248 V22E probably damaging Het
Mad1l1 T C 5: 140,193,984 E383G probably damaging Het
Man2b1 T A 8: 85,091,071 probably null Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Myo18a T A 11: 77,845,515 M1546K probably benign Het
Ntf3 T C 6: 126,101,845 T233A probably damaging Het
Olfr600 C T 7: 103,346,815 V38I probably benign Het
Omg T C 11: 79,501,938 S365G probably benign Het
Palm2 T A 4: 57,709,973 V306D probably damaging Het
Pde4dip A T 3: 97,718,236 Y1349N probably damaging Het
Pitpnm2 A G 5: 124,133,406 L368P probably damaging Het
Pnpla8 T A 12: 44,283,247 I194K possibly damaging Het
Podn T C 4: 108,024,273 probably null Het
Pramel6 A T 2: 87,509,579 E229V possibly damaging Het
Ptpro C T 6: 137,449,917 P262L probably damaging Het
Rnf122 A T 8: 31,118,460 T19S probably benign Het
Shank2 T A 7: 144,081,848 Y320N possibly damaging Het
Slc2a9 A C 5: 38,391,721 I243S probably damaging Het
Slc5a6 A T 5: 31,040,405 M130K probably benign Het
Stx5a A G 19: 8,755,169 probably benign Het
Tbr1 G T 2: 61,811,735 G185V probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tg A G 15: 66,693,358 D1183G probably benign Het
Thbs1 A T 2: 118,119,952 I689F probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trub2 A T 2: 29,787,784 probably benign Het
Ttn A G 2: 76,766,962 V19869A probably damaging Het
Tufm T C 7: 126,489,435 V303A possibly damaging Het
Vezf1 T C 11: 88,073,319 I99T possibly damaging Het
Vmn2r1 T C 3: 64,081,697 V19A probably benign Het
Xpc C T 6: 91,504,023 R289K probably damaging Het
Zfp811 T A 17: 32,797,432 K545* probably null Het
Zmiz2 G A 11: 6,402,413 D623N probably damaging Het
Other mutations in Otol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Otol1 APN 3 70027724 missense probably damaging 1.00
IGL01664:Otol1 APN 3 70027797 missense probably benign 0.01
IGL02205:Otol1 APN 3 70018596 missense probably benign
IGL02445:Otol1 APN 3 70028034 missense probably damaging 1.00
IGL02674:Otol1 APN 3 70018744 missense probably benign 0.01
IGL03376:Otol1 APN 3 70027512 missense probably damaging 0.96
R0094:Otol1 UTSW 3 70018683 missense probably benign 0.03
R0492:Otol1 UTSW 3 70027784 missense probably damaging 0.99
R0504:Otol1 UTSW 3 70027604 missense probably damaging 1.00
R1932:Otol1 UTSW 3 70028104 missense probably benign 0.01
R2049:Otol1 UTSW 3 70018836 missense probably benign 0.06
R2321:Otol1 UTSW 3 70018525 nonsense probably null
R4042:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4043:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4044:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4092:Otol1 UTSW 3 70027785 missense probably damaging 0.99
R4433:Otol1 UTSW 3 70018548 missense probably benign 0.02
R4993:Otol1 UTSW 3 70018878 missense probably benign 0.07
R6921:Otol1 UTSW 3 70028100 missense possibly damaging 0.89
R7095:Otol1 UTSW 3 70018694 missense probably benign 0.00
R7619:Otol1 UTSW 3 70027869 missense probably damaging 1.00
RF019:Otol1 UTSW 3 70018600 missense probably benign 0.00
X0062:Otol1 UTSW 3 70027640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCTATCATGTCACTGTCAGGG -3'
(R):5'- TAGGAATAGTTGACACTATGCTGG -3'

Sequencing Primer
(F):5'- ATGTCACTGTCAGGGGTCGAC -3'
(R):5'- CAGAAGTACAGTGTCCAAAG -3'
Posted On2018-11-28