Incidental Mutation 'R6983:Dennd4c'
ID542772
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6983 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86799493 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 576 (Y576H)
Ref Sequence ENSEMBL: ENSMUSP00000080685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect probably damaging
Transcript: ENSMUST00000045512
AA Change: Y576H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: Y576H

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082026
AA Change: Y576H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: Y576H

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142837
AA Change: Y576H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: Y576H

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,228,250 probably null Het
5730559C18Rik A G 1: 136,220,156 S353P possibly damaging Het
Abca15 T C 7: 120,354,463 V530A probably benign Het
Adgrg6 T C 10: 14,431,695 N816D probably damaging Het
Aebp2 T C 6: 140,637,663 F288L possibly damaging Het
Afdn T C 17: 13,881,321 S1024P probably damaging Het
Akap6 A C 12: 52,887,653 K643Q probably damaging Het
Atg2a A T 19: 6,260,040 D1751V probably damaging Het
Best2 T A 8: 85,009,776 I253F probably benign Het
Bmp1 G T 14: 70,508,207 P55T probably damaging Het
C1s1 C A 6: 124,540,896 V42F possibly damaging Het
Ccdc115 A G 1: 34,439,041 probably null Het
Cdc42bpg C T 19: 6,321,668 P1326S probably damaging Het
Cdhr3 G A 12: 33,042,380 T744I probably benign Het
Cit T G 5: 115,994,091 L1745R probably damaging Het
Commd6 A T 14: 101,637,052 S39T probably damaging Het
Crot T G 5: 8,978,280 Y223S probably benign Het
Crybg1 G T 10: 43,999,342 A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 E841K probably damaging Het
Diaph1 A T 18: 37,889,769 V749E probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
F5 A T 1: 164,194,129 D1391V probably damaging Het
Foxf2 T A 13: 31,627,197 M373K probably benign Het
Fstl1 A T 16: 37,831,618 E287D probably benign Het
Gltpd2 T C 11: 70,520,284 Y134H probably damaging Het
Hemgn T A 4: 46,395,997 H413L possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hykk T C 9: 54,946,509 S372P probably benign Het
Ints10 T C 8: 68,794,051 V11A probably damaging Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Lamtor2 G A 3: 88,552,839 Q9* probably null Het
Lonp2 T A 8: 86,624,248 V22E probably damaging Het
Mad1l1 T C 5: 140,193,984 E383G probably damaging Het
Man2b1 T A 8: 85,091,071 probably null Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Myo18a T A 11: 77,845,515 M1546K probably benign Het
Ntf3 T C 6: 126,101,845 T233A probably damaging Het
Olfr600 C T 7: 103,346,815 V38I probably benign Het
Omg T C 11: 79,501,938 S365G probably benign Het
Otol1 T A 3: 70,028,041 N455K probably damaging Het
Palm2 T A 4: 57,709,973 V306D probably damaging Het
Pde4dip A T 3: 97,718,236 Y1349N probably damaging Het
Pitpnm2 A G 5: 124,133,406 L368P probably damaging Het
Pnpla8 T A 12: 44,283,247 I194K possibly damaging Het
Podn T C 4: 108,024,273 probably null Het
Pramel6 A T 2: 87,509,579 E229V possibly damaging Het
Ptpro C T 6: 137,449,917 P262L probably damaging Het
Rnf122 A T 8: 31,118,460 T19S probably benign Het
Shank2 T A 7: 144,081,848 Y320N possibly damaging Het
Slc2a9 A C 5: 38,391,721 I243S probably damaging Het
Slc5a6 A T 5: 31,040,405 M130K probably benign Het
Stx5a A G 19: 8,755,169 probably benign Het
Tbr1 G T 2: 61,811,735 G185V probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tg A G 15: 66,693,358 D1183G probably benign Het
Thbs1 A T 2: 118,119,952 I689F probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trub2 A T 2: 29,787,784 probably benign Het
Ttn A G 2: 76,766,962 V19869A probably damaging Het
Tufm T C 7: 126,489,435 V303A possibly damaging Het
Vezf1 T C 11: 88,073,319 I99T possibly damaging Het
Vmn2r1 T C 3: 64,081,697 V19A probably benign Het
Xpc C T 6: 91,504,023 R289K probably damaging Het
Zfp811 T A 17: 32,797,432 K545* probably null Het
Zmiz2 G A 11: 6,402,413 D623N probably damaging Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
R7599:Dennd4c UTSW 4 86811612 missense probably damaging 1.00
R7688:Dennd4c UTSW 4 86795140 missense probably damaging 1.00
R7725:Dennd4c UTSW 4 86786093 missense probably benign 0.00
R7751:Dennd4c UTSW 4 86828942 missense probably benign 0.05
R7790:Dennd4c UTSW 4 86799517 missense probably damaging 0.96
R8056:Dennd4c UTSW 4 86844976 missense probably null 0.71
R8307:Dennd4c UTSW 4 86825872 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGTTCCAACCTGCTGTGTAG -3'
(R):5'- GGTAGGTTACAGGAAATGCAAATTCC -3'

Sequencing Primer
(F):5'- GAGACAGGGTTTCTCCATATAGCC -3'
(R):5'- GCAACTGTCATCTCACTG -3'
Posted On2018-11-28