Incidental Mutation 'R6983:Ptpro'
ID542783
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6983 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137449917 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 262 (P262L)
Ref Sequence ENSEMBL: ENSMUSP00000144870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: P1111L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: P1111L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167002
AA Change: P290L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: P290L

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: P1083L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: P1083L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203914
AA Change: P262L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: P262L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Meta Mutation Damage Score 0.9615 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,228,250 probably null Het
5730559C18Rik A G 1: 136,220,156 S353P possibly damaging Het
Abca15 T C 7: 120,354,463 V530A probably benign Het
Adgrg6 T C 10: 14,431,695 N816D probably damaging Het
Aebp2 T C 6: 140,637,663 F288L possibly damaging Het
Afdn T C 17: 13,881,321 S1024P probably damaging Het
Akap6 A C 12: 52,887,653 K643Q probably damaging Het
Atg2a A T 19: 6,260,040 D1751V probably damaging Het
Best2 T A 8: 85,009,776 I253F probably benign Het
Bmp1 G T 14: 70,508,207 P55T probably damaging Het
C1s1 C A 6: 124,540,896 V42F possibly damaging Het
Ccdc115 A G 1: 34,439,041 probably null Het
Cdc42bpg C T 19: 6,321,668 P1326S probably damaging Het
Cdhr3 G A 12: 33,042,380 T744I probably benign Het
Cit T G 5: 115,994,091 L1745R probably damaging Het
Commd6 A T 14: 101,637,052 S39T probably damaging Het
Crot T G 5: 8,978,280 Y223S probably benign Het
Crybg1 G T 10: 43,999,342 A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 E841K probably damaging Het
Dennd4c T C 4: 86,799,493 Y576H probably damaging Het
Diaph1 A T 18: 37,889,769 V749E probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
F5 A T 1: 164,194,129 D1391V probably damaging Het
Foxf2 T A 13: 31,627,197 M373K probably benign Het
Fstl1 A T 16: 37,831,618 E287D probably benign Het
Gltpd2 T C 11: 70,520,284 Y134H probably damaging Het
Hemgn T A 4: 46,395,997 H413L possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hykk T C 9: 54,946,509 S372P probably benign Het
Ints10 T C 8: 68,794,051 V11A probably damaging Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Lamtor2 G A 3: 88,552,839 Q9* probably null Het
Lonp2 T A 8: 86,624,248 V22E probably damaging Het
Mad1l1 T C 5: 140,193,984 E383G probably damaging Het
Man2b1 T A 8: 85,091,071 probably null Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Myo18a T A 11: 77,845,515 M1546K probably benign Het
Ntf3 T C 6: 126,101,845 T233A probably damaging Het
Olfr600 C T 7: 103,346,815 V38I probably benign Het
Omg T C 11: 79,501,938 S365G probably benign Het
Otol1 T A 3: 70,028,041 N455K probably damaging Het
Palm2 T A 4: 57,709,973 V306D probably damaging Het
Pde4dip A T 3: 97,718,236 Y1349N probably damaging Het
Pitpnm2 A G 5: 124,133,406 L368P probably damaging Het
Pnpla8 T A 12: 44,283,247 I194K possibly damaging Het
Podn T C 4: 108,024,273 probably null Het
Pramel6 A T 2: 87,509,579 E229V possibly damaging Het
Rnf122 A T 8: 31,118,460 T19S probably benign Het
Shank2 T A 7: 144,081,848 Y320N possibly damaging Het
Slc2a9 A C 5: 38,391,721 I243S probably damaging Het
Slc5a6 A T 5: 31,040,405 M130K probably benign Het
Stx5a A G 19: 8,755,169 probably benign Het
Tbr1 G T 2: 61,811,735 G185V probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tg A G 15: 66,693,358 D1183G probably benign Het
Thbs1 A T 2: 118,119,952 I689F probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trub2 A T 2: 29,787,784 probably benign Het
Ttn A G 2: 76,766,962 V19869A probably damaging Het
Tufm T C 7: 126,489,435 V303A possibly damaging Het
Vezf1 T C 11: 88,073,319 I99T possibly damaging Het
Vmn2r1 T C 3: 64,081,697 V19A probably benign Het
Xpc C T 6: 91,504,023 R289K probably damaging Het
Zfp811 T A 17: 32,797,432 K545* probably null Het
Zmiz2 G A 11: 6,402,413 D623N probably damaging Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
Brau UTSW 6 137454598 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
Hoff UTSW 6 137443594 missense probably damaging 1.00
Jester UTSW 6 137449917 missense probably damaging 1.00
mann UTSW 6 137411116 splice site probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R7019:Ptpro UTSW 6 137380478 missense probably benign
R7218:Ptpro UTSW 6 137454598 missense probably damaging 1.00
R7236:Ptpro UTSW 6 137368337 missense probably damaging 1.00
R7299:Ptpro UTSW 6 137441144 critical splice donor site probably null
R7381:Ptpro UTSW 6 137399561 missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137382649 missense probably benign 0.01
R7733:Ptpro UTSW 6 137414286 nonsense probably null
R7793:Ptpro UTSW 6 137416820 missense probably damaging 0.99
R7804:Ptpro UTSW 6 137399601 splice site probably null
R7833:Ptpro UTSW 6 137416863 nonsense probably null
R7859:Ptpro UTSW 6 137392807 critical splice donor site probably null
R7873:Ptpro UTSW 6 137430739 missense probably benign 0.44
R8042:Ptpro UTSW 6 137416883 missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137426784 nonsense probably null
Z1177:Ptpro UTSW 6 137378140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGTGCTCAGAGCTCAGAAG -3'
(R):5'- GACTAAACCCTTGAGCTCAGC -3'

Sequencing Primer
(F):5'- TGCTCAGAGCTCAGAAGAGATG -3'
(R):5'- CCTAAAGGAGCTATTCTCGGG -3'
Posted On2018-11-28