Incidental Mutation 'R6983:Shank2'
ID542789
Institutional Source Beutler Lab
Gene Symbol Shank2
Ensembl Gene ENSMUSG00000037541
Gene NameSH3 and multiple ankyrin repeat domains 2
SynonymsProSAP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6983 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location144001928-144424494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144081848 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 320 (Y320N)
Ref Sequence ENSEMBL: ENSMUSP00000101522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105902] [ENSMUST00000213146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105902
AA Change: Y320N

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: Y320N

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:FERM_f0 57 140 1.4e-21 PFAM
ANK 196 226 1.4e1 SMART
ANK 230 259 2.77e-3 SMART
ANK 263 293 1.42e0 SMART
ANK 297 326 1.25e-1 SMART
ANK 330 359 7.83e-3 SMART
ANK 363 391 1.29e2 SMART
SH3 529 584 1.04e-14 SMART
PDZ 635 720 1.75e-14 SMART
low complexity region 724 743 N/A INTRINSIC
low complexity region 878 893 N/A INTRINSIC
low complexity region 1031 1043 N/A INTRINSIC
low complexity region 1118 1129 N/A INTRINSIC
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1462 1473 N/A INTRINSIC
low complexity region 1494 1516 N/A INTRINSIC
low complexity region 1530 1546 N/A INTRINSIC
low complexity region 1568 1576 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
low complexity region 1713 1728 N/A INTRINSIC
low complexity region 1752 1766 N/A INTRINSIC
SAM 1775 1841 2.52e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213146
AA Change: Y320N

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,228,250 probably null Het
5730559C18Rik A G 1: 136,220,156 S353P possibly damaging Het
Abca15 T C 7: 120,354,463 V530A probably benign Het
Adgrg6 T C 10: 14,431,695 N816D probably damaging Het
Aebp2 T C 6: 140,637,663 F288L possibly damaging Het
Afdn T C 17: 13,881,321 S1024P probably damaging Het
Akap6 A C 12: 52,887,653 K643Q probably damaging Het
Atg2a A T 19: 6,260,040 D1751V probably damaging Het
Best2 T A 8: 85,009,776 I253F probably benign Het
Bmp1 G T 14: 70,508,207 P55T probably damaging Het
C1s1 C A 6: 124,540,896 V42F possibly damaging Het
Ccdc115 A G 1: 34,439,041 probably null Het
Cdc42bpg C T 19: 6,321,668 P1326S probably damaging Het
Cdhr3 G A 12: 33,042,380 T744I probably benign Het
Cit T G 5: 115,994,091 L1745R probably damaging Het
Commd6 A T 14: 101,637,052 S39T probably damaging Het
Crot T G 5: 8,978,280 Y223S probably benign Het
Crybg1 G T 10: 43,999,342 A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 E841K probably damaging Het
Dennd4c T C 4: 86,799,493 Y576H probably damaging Het
Diaph1 A T 18: 37,889,769 V749E probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
F5 A T 1: 164,194,129 D1391V probably damaging Het
Foxf2 T A 13: 31,627,197 M373K probably benign Het
Fstl1 A T 16: 37,831,618 E287D probably benign Het
Gltpd2 T C 11: 70,520,284 Y134H probably damaging Het
Hemgn T A 4: 46,395,997 H413L possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hykk T C 9: 54,946,509 S372P probably benign Het
Ints10 T C 8: 68,794,051 V11A probably damaging Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Lamtor2 G A 3: 88,552,839 Q9* probably null Het
Lonp2 T A 8: 86,624,248 V22E probably damaging Het
Mad1l1 T C 5: 140,193,984 E383G probably damaging Het
Man2b1 T A 8: 85,091,071 probably null Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Myo18a T A 11: 77,845,515 M1546K probably benign Het
Ntf3 T C 6: 126,101,845 T233A probably damaging Het
Olfr600 C T 7: 103,346,815 V38I probably benign Het
Omg T C 11: 79,501,938 S365G probably benign Het
Otol1 T A 3: 70,028,041 N455K probably damaging Het
Palm2 T A 4: 57,709,973 V306D probably damaging Het
Pde4dip A T 3: 97,718,236 Y1349N probably damaging Het
Pitpnm2 A G 5: 124,133,406 L368P probably damaging Het
Pnpla8 T A 12: 44,283,247 I194K possibly damaging Het
Podn T C 4: 108,024,273 probably null Het
Pramel6 A T 2: 87,509,579 E229V possibly damaging Het
Ptpro C T 6: 137,449,917 P262L probably damaging Het
Rnf122 A T 8: 31,118,460 T19S probably benign Het
Slc2a9 A C 5: 38,391,721 I243S probably damaging Het
Slc5a6 A T 5: 31,040,405 M130K probably benign Het
Stx5a A G 19: 8,755,169 probably benign Het
Tbr1 G T 2: 61,811,735 G185V probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tg A G 15: 66,693,358 D1183G probably benign Het
Thbs1 A T 2: 118,119,952 I689F probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trub2 A T 2: 29,787,784 probably benign Het
Ttn A G 2: 76,766,962 V19869A probably damaging Het
Tufm T C 7: 126,489,435 V303A possibly damaging Het
Vezf1 T C 11: 88,073,319 I99T possibly damaging Het
Vmn2r1 T C 3: 64,081,697 V19A probably benign Het
Xpc C T 6: 91,504,023 R289K probably damaging Het
Zfp811 T A 17: 32,797,432 K545* probably null Het
Zmiz2 G A 11: 6,402,413 D623N probably damaging Het
Other mutations in Shank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Shank2 APN 7 144411847 missense probably damaging 1.00
IGL00516:Shank2 APN 7 144410775 missense possibly damaging 0.96
IGL00919:Shank2 APN 7 144411271 missense probably damaging 0.97
IGL01450:Shank2 APN 7 144285068 nonsense probably null
IGL01996:Shank2 APN 7 144411493 missense probably damaging 1.00
IGL02217:Shank2 APN 7 144285047 missense possibly damaging 0.59
IGL02314:Shank2 APN 7 144411271 missense probably benign 0.01
IGL02320:Shank2 APN 7 144420944 missense probably damaging 1.00
IGL02948:Shank2 APN 7 144409636 missense probably benign 0.03
IGL02997:Shank2 APN 7 144081873 missense probably benign 0.16
R0077:Shank2 UTSW 7 144192467 missense possibly damaging 0.85
R0109:Shank2 UTSW 7 144410577 missense possibly damaging 0.81
R0126:Shank2 UTSW 7 144031355 missense probably damaging 0.99
R0153:Shank2 UTSW 7 144070135 missense probably benign 0.04
R0644:Shank2 UTSW 7 144411849 missense probably benign
R1072:Shank2 UTSW 7 144411568 missense probably damaging 1.00
R1245:Shank2 UTSW 7 144411720 missense probably benign 0.00
R1424:Shank2 UTSW 7 144052372 missense probably damaging 0.99
R1712:Shank2 UTSW 7 144411153 missense probably damaging 1.00
R1739:Shank2 UTSW 7 144179853 missense probably damaging 1.00
R1791:Shank2 UTSW 7 144410599 missense probably damaging 1.00
R1889:Shank2 UTSW 7 144186858 nonsense probably null
R2074:Shank2 UTSW 7 144409540 missense probably damaging 1.00
R2135:Shank2 UTSW 7 144411234 missense probably damaging 0.99
R2355:Shank2 UTSW 7 144057718 missense possibly damaging 0.94
R2511:Shank2 UTSW 7 144411577 missense probably damaging 1.00
R2517:Shank2 UTSW 7 144052305 missense possibly damaging 0.89
R2570:Shank2 UTSW 7 144068770 missense probably damaging 1.00
R2846:Shank2 UTSW 7 144070055 missense probably damaging 1.00
R3159:Shank2 UTSW 7 144081874 missense probably damaging 0.98
R3881:Shank2 UTSW 7 144405384 missense probably benign
R3907:Shank2 UTSW 7 144409576 missense probably damaging 1.00
R3938:Shank2 UTSW 7 144128375 missense probably benign 0.20
R4151:Shank2 UTSW 7 144054828 missense probably damaging 1.00
R4369:Shank2 UTSW 7 144179781 missense probably damaging 0.99
R4372:Shank2 UTSW 7 144410862 missense probably benign 0.09
R4519:Shank2 UTSW 7 144410205 missense probably damaging 1.00
R4627:Shank2 UTSW 7 144411424 missense probably damaging 1.00
R4645:Shank2 UTSW 7 144410422 missense possibly damaging 0.65
R4647:Shank2 UTSW 7 144411829 missense probably damaging 1.00
R4689:Shank2 UTSW 7 144420605 missense probably benign 0.07
R4751:Shank2 UTSW 7 144409468 missense probably damaging 1.00
R4816:Shank2 UTSW 7 144052306 missense probably damaging 1.00
R4843:Shank2 UTSW 7 144031409 missense probably benign 0.17
R4929:Shank2 UTSW 7 144411271 missense probably benign 0.01
R5009:Shank2 UTSW 7 144070179 missense probably benign 0.00
R5027:Shank2 UTSW 7 144259105 nonsense probably null
R5165:Shank2 UTSW 7 144409636 missense possibly damaging 0.62
R5278:Shank2 UTSW 7 144068875 critical splice donor site probably null
R5332:Shank2 UTSW 7 144411292 missense possibly damaging 0.82
R5497:Shank2 UTSW 7 144409534 missense probably damaging 1.00
R5525:Shank2 UTSW 7 144070109 missense probably damaging 1.00
R5575:Shank2 UTSW 7 144410134 missense probably damaging 1.00
R5948:Shank2 UTSW 7 144407223 missense probably damaging 0.98
R6024:Shank2 UTSW 7 144180031 missense probably benign 0.12
R6306:Shank2 UTSW 7 144409680 missense probably benign 0.00
R6317:Shank2 UTSW 7 144285084 missense possibly damaging 0.89
R6358:Shank2 UTSW 7 144031297 missense probably benign 0.25
R6364:Shank2 UTSW 7 144410409 missense probably benign 0.14
R6413:Shank2 UTSW 7 144410218 missense probably damaging 1.00
R6680:Shank2 UTSW 7 144420866 missense probably damaging 1.00
R6834:Shank2 UTSW 7 144409894 missense probably damaging 1.00
R6870:Shank2 UTSW 7 144052460 missense probably damaging 0.99
R6933:Shank2 UTSW 7 144091778 missense probably benign 0.19
R7082:Shank2 UTSW 7 144410359 missense probably damaging 0.99
R7100:Shank2 UTSW 7 144411164 missense possibly damaging 0.73
R7111:Shank2 UTSW 7 144411552 missense probably benign 0.00
R7213:Shank2 UTSW 7 144031409 missense probably benign 0.17
R7225:Shank2 UTSW 7 144285025 missense probably benign 0.42
R7325:Shank2 UTSW 7 144411685 missense probably benign 0.04
R7605:Shank2 UTSW 7 144091779 missense possibly damaging 0.64
R7909:Shank2 UTSW 7 144411394 missense probably damaging 1.00
R7976:Shank2 UTSW 7 144411061 missense probably damaging 0.99
R8118:Shank2 UTSW 7 144409875 missense probably benign 0.01
RF009:Shank2 UTSW 7 144411571 missense possibly damaging 0.81
Z1176:Shank2 UTSW 7 144128377 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAATCTAGCCAGCAGAGAGC -3'
(R):5'- TGACTGTAGATCTGGAATGTGACC -3'

Sequencing Primer
(F):5'- CACTGGGGTCTCAGTCTCAGAAC -3'
(R):5'- CTCTGGTTCTCAGTAAGGCAGCAG -3'
Posted On2018-11-28