Incidental Mutation 'R6983:Crybg1'
ID542797
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Namecrystallin beta-gamma domain containing 1
SynonymsAim1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6983 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location43950636-44148853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43999342 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 590 (A590D)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
Predicted Effect probably damaging
Transcript: ENSMUST00000020017
AA Change: A216D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: A216D

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200401
AA Change: A590D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: A590D

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,228,250 probably null Het
5730559C18Rik A G 1: 136,220,156 S353P possibly damaging Het
Abca15 T C 7: 120,354,463 V530A probably benign Het
Adgrg6 T C 10: 14,431,695 N816D probably damaging Het
Aebp2 T C 6: 140,637,663 F288L possibly damaging Het
Afdn T C 17: 13,881,321 S1024P probably damaging Het
Akap6 A C 12: 52,887,653 K643Q probably damaging Het
Atg2a A T 19: 6,260,040 D1751V probably damaging Het
Best2 T A 8: 85,009,776 I253F probably benign Het
Bmp1 G T 14: 70,508,207 P55T probably damaging Het
C1s1 C A 6: 124,540,896 V42F possibly damaging Het
Ccdc115 A G 1: 34,439,041 probably null Het
Cdc42bpg C T 19: 6,321,668 P1326S probably damaging Het
Cdhr3 G A 12: 33,042,380 T744I probably benign Het
Cit T G 5: 115,994,091 L1745R probably damaging Het
Commd6 A T 14: 101,637,052 S39T probably damaging Het
Crot T G 5: 8,978,280 Y223S probably benign Het
Cwf19l2 G A 9: 3,477,817 E841K probably damaging Het
Dennd4c T C 4: 86,799,493 Y576H probably damaging Het
Diaph1 A T 18: 37,889,769 V749E probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
F5 A T 1: 164,194,129 D1391V probably damaging Het
Foxf2 T A 13: 31,627,197 M373K probably benign Het
Fstl1 A T 16: 37,831,618 E287D probably benign Het
Gltpd2 T C 11: 70,520,284 Y134H probably damaging Het
Hemgn T A 4: 46,395,997 H413L possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hykk T C 9: 54,946,509 S372P probably benign Het
Ints10 T C 8: 68,794,051 V11A probably damaging Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Lamtor2 G A 3: 88,552,839 Q9* probably null Het
Lonp2 T A 8: 86,624,248 V22E probably damaging Het
Mad1l1 T C 5: 140,193,984 E383G probably damaging Het
Man2b1 T A 8: 85,091,071 probably null Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Myo18a T A 11: 77,845,515 M1546K probably benign Het
Ntf3 T C 6: 126,101,845 T233A probably damaging Het
Olfr600 C T 7: 103,346,815 V38I probably benign Het
Omg T C 11: 79,501,938 S365G probably benign Het
Otol1 T A 3: 70,028,041 N455K probably damaging Het
Palm2 T A 4: 57,709,973 V306D probably damaging Het
Pde4dip A T 3: 97,718,236 Y1349N probably damaging Het
Pitpnm2 A G 5: 124,133,406 L368P probably damaging Het
Pnpla8 T A 12: 44,283,247 I194K possibly damaging Het
Podn T C 4: 108,024,273 probably null Het
Pramel6 A T 2: 87,509,579 E229V possibly damaging Het
Ptpro C T 6: 137,449,917 P262L probably damaging Het
Rnf122 A T 8: 31,118,460 T19S probably benign Het
Shank2 T A 7: 144,081,848 Y320N possibly damaging Het
Slc2a9 A C 5: 38,391,721 I243S probably damaging Het
Slc5a6 A T 5: 31,040,405 M130K probably benign Het
Stx5a A G 19: 8,755,169 probably benign Het
Tbr1 G T 2: 61,811,735 G185V probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tg A G 15: 66,693,358 D1183G probably benign Het
Thbs1 A T 2: 118,119,952 I689F probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trub2 A T 2: 29,787,784 probably benign Het
Ttn A G 2: 76,766,962 V19869A probably damaging Het
Tufm T C 7: 126,489,435 V303A possibly damaging Het
Vezf1 T C 11: 88,073,319 I99T possibly damaging Het
Vmn2r1 T C 3: 64,081,697 V19A probably benign Het
Xpc C T 6: 91,504,023 R289K probably damaging Het
Zfp811 T A 17: 32,797,432 K545* probably null Het
Zmiz2 G A 11: 6,402,413 D623N probably damaging Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43998898 missense probably benign 0.03
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43973798 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43998758 missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43967743 missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R5835:Crybg1 UTSW 10 43975133 missense probably benign 0.28
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43997259 missense probably benign 0.03
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43997623 nonsense probably null
R7293:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43997258 missense probably benign 0.05
R7313:Crybg1 UTSW 10 43989111 missense probably damaging 0.98
R7373:Crybg1 UTSW 10 44004140 missense probably benign 0.00
R7449:Crybg1 UTSW 10 44004519 missense probably benign
R7530:Crybg1 UTSW 10 43999073 missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43998835 missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43989143 missense probably benign 0.06
R8359:Crybg1 UTSW 10 43992542 missense probably benign 0.03
RF005:Crybg1 UTSW 10 44004745 missense probably benign 0.03
RF024:Crybg1 UTSW 10 44004745 missense probably benign 0.03
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTGTGTTACGGACGTC -3'
(R):5'- GTAATGTCTGCCAGTTCAGTGC -3'

Sequencing Primer
(F):5'- TTACGGACGTCGGGGTG -3'
(R):5'- GCCAGTTCAGTGCCACTCAC -3'
Posted On2018-11-28