Incidental Mutation 'R6983:Tg'
ID 542810
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission 045090-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R6983 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 66542606-66722570 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66565207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1183 (D1183G)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000065916
AA Change: D1183G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: D1183G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,953,686 (GRCm39) V530A probably benign Het
Adgrg6 T C 10: 14,307,439 (GRCm39) N816D probably damaging Het
Aebp2 T C 6: 140,583,389 (GRCm39) F288L possibly damaging Het
Afdn T C 17: 14,101,583 (GRCm39) S1024P probably damaging Het
Akap6 A C 12: 52,934,436 (GRCm39) K643Q probably damaging Het
Atg2a A T 19: 6,310,070 (GRCm39) D1751V probably damaging Het
Best2 T A 8: 85,736,405 (GRCm39) I253F probably benign Het
Bmp1 G T 14: 70,745,647 (GRCm39) P55T probably damaging Het
C1s1 C A 6: 124,517,855 (GRCm39) V42F possibly damaging Het
Ccdc115 A G 1: 34,478,122 (GRCm39) probably null Het
Cdc42bpg C T 19: 6,371,698 (GRCm39) P1326S probably damaging Het
Cdhr3 G A 12: 33,092,379 (GRCm39) T744I probably benign Het
Cit T G 5: 116,132,150 (GRCm39) L1745R probably damaging Het
Commd6 A T 14: 101,874,488 (GRCm39) S39T probably damaging Het
Crot T G 5: 9,028,280 (GRCm39) Y223S probably benign Het
Crybg1 G T 10: 43,875,338 (GRCm39) A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 (GRCm39) E841K probably damaging Het
Dennd4c T C 4: 86,717,730 (GRCm39) Y576H probably damaging Het
Diaph1 A T 18: 38,022,822 (GRCm39) V749E probably damaging Het
Ell2 C A 13: 75,910,006 (GRCm39) L119M probably damaging Het
F5 A T 1: 164,021,698 (GRCm39) D1391V probably damaging Het
Foxf2 T A 13: 31,811,180 (GRCm39) M373K probably benign Het
Fstl1 A T 16: 37,651,980 (GRCm39) E287D probably benign Het
Gltpd2 T C 11: 70,411,110 (GRCm39) Y134H probably damaging Het
Hemgn T A 4: 46,395,997 (GRCm39) H413L possibly damaging Het
Herc2 G A 7: 55,756,201 (GRCm39) R747H possibly damaging Het
Hykk T C 9: 54,853,793 (GRCm39) S372P probably benign Het
Inava A G 1: 136,147,894 (GRCm39) S353P possibly damaging Het
Ints10 T C 8: 69,246,703 (GRCm39) V11A probably damaging Het
Khdrbs1 A G 4: 129,614,635 (GRCm39) V306A probably benign Het
Lamtor2 G A 3: 88,460,146 (GRCm39) Q9* probably null Het
Lonp2 T A 8: 87,350,876 (GRCm39) V22E probably damaging Het
Mad1l1 T C 5: 140,179,739 (GRCm39) E383G probably damaging Het
Man2b1 T A 8: 85,817,700 (GRCm39) probably null Het
Mtch1 T C 17: 29,557,750 (GRCm39) I243V probably damaging Het
Myo18a T A 11: 77,736,341 (GRCm39) M1546K probably benign Het
Ntf3 T C 6: 126,078,808 (GRCm39) T233A probably damaging Het
Omg T C 11: 79,392,764 (GRCm39) S365G probably benign Het
Or52ad1 C T 7: 102,996,022 (GRCm39) V38I probably benign Het
Otol1 T A 3: 69,935,374 (GRCm39) N455K probably damaging Het
Pakap T A 4: 57,709,973 (GRCm39) V306D probably damaging Het
Pde4dip A T 3: 97,625,552 (GRCm39) Y1349N probably damaging Het
Pitpnm2 A G 5: 124,271,469 (GRCm39) L368P probably damaging Het
Pnpla8 T A 12: 44,330,030 (GRCm39) I194K possibly damaging Het
Podn T C 4: 107,881,470 (GRCm39) probably null Het
Potefam1 A G 2: 111,058,595 (GRCm39) probably null Het
Pramel6 A T 2: 87,339,923 (GRCm39) E229V possibly damaging Het
Ptpro C T 6: 137,426,915 (GRCm39) P262L probably damaging Het
Rnf122 A T 8: 31,608,488 (GRCm39) T19S probably benign Het
Shank2 T A 7: 143,635,585 (GRCm39) Y320N possibly damaging Het
Slc2a9 A C 5: 38,549,064 (GRCm39) I243S probably damaging Het
Slc5a6 A T 5: 31,197,749 (GRCm39) M130K probably benign Het
Stx5a A G 19: 8,732,533 (GRCm39) probably benign Het
Tbr1 G T 2: 61,642,079 (GRCm39) G185V probably damaging Het
Thbs1 A T 2: 117,950,433 (GRCm39) I689F probably damaging Het
Ticam1 C T 17: 56,576,900 (GRCm39) E732K probably benign Het
Trgv6 G T 13: 19,374,814 (GRCm39) G40W possibly damaging Het
Trub2 A T 2: 29,677,796 (GRCm39) probably benign Het
Ttn A G 2: 76,597,306 (GRCm39) V19869A probably damaging Het
Tufm T C 7: 126,088,607 (GRCm39) V303A possibly damaging Het
Vezf1 T C 11: 87,964,145 (GRCm39) I99T possibly damaging Het
Vmn2r1 T C 3: 63,989,118 (GRCm39) V19A probably benign Het
Xpc C T 6: 91,481,005 (GRCm39) R289K probably damaging Het
Zfp811 T A 17: 33,016,406 (GRCm39) K545* probably null Het
Zmiz2 G A 11: 6,352,413 (GRCm39) D623N probably damaging Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66,719,015 (GRCm39) missense probably damaging 1.00
IGL00230:Tg APN 15 66,699,139 (GRCm39) missense probably benign 0.00
IGL00324:Tg APN 15 66,565,273 (GRCm39) missense probably benign
IGL00428:Tg APN 15 66,645,273 (GRCm39) missense probably benign 0.33
IGL00703:Tg APN 15 66,568,338 (GRCm39) missense probably benign 0.34
IGL00808:Tg APN 15 66,555,662 (GRCm39) missense probably damaging 1.00
IGL00833:Tg APN 15 66,560,650 (GRCm39) missense probably benign 0.34
IGL00899:Tg APN 15 66,545,922 (GRCm39) critical splice donor site probably null
IGL00921:Tg APN 15 66,636,302 (GRCm39) missense probably benign 0.28
IGL00975:Tg APN 15 66,553,731 (GRCm39) missense probably benign
IGL01288:Tg APN 15 66,608,125 (GRCm39) missense possibly damaging 0.81
IGL01397:Tg APN 15 66,567,941 (GRCm39) splice site probably benign
IGL01634:Tg APN 15 66,601,415 (GRCm39) missense probably benign 0.34
IGL01646:Tg APN 15 66,549,936 (GRCm39) missense probably damaging 1.00
IGL01704:Tg APN 15 66,543,200 (GRCm39) missense probably damaging 0.98
IGL01958:Tg APN 15 66,631,335 (GRCm39) missense probably benign 0.06
IGL02093:Tg APN 15 66,564,223 (GRCm39) missense possibly damaging 0.83
IGL02113:Tg APN 15 66,577,179 (GRCm39) missense probably benign 0.08
IGL02138:Tg APN 15 66,589,082 (GRCm39) missense probably benign 0.01
IGL02156:Tg APN 15 66,577,197 (GRCm39) missense probably benign 0.19
IGL02169:Tg APN 15 66,629,792 (GRCm39) missense probably benign 0.04
IGL02342:Tg APN 15 66,636,140 (GRCm39) missense probably benign
IGL02434:Tg APN 15 66,636,191 (GRCm39) missense probably damaging 0.97
IGL02506:Tg APN 15 66,613,443 (GRCm39) missense possibly damaging 0.71
IGL02513:Tg APN 15 66,577,123 (GRCm39) missense probably benign
IGL02549:Tg APN 15 66,711,210 (GRCm39) missense probably damaging 1.00
IGL02669:Tg APN 15 66,620,575 (GRCm39) splice site probably benign
IGL02756:Tg APN 15 66,606,435 (GRCm39) missense probably benign
IGL02800:Tg APN 15 66,629,735 (GRCm39) missense probably damaging 1.00
IGL02828:Tg APN 15 66,554,243 (GRCm39) missense probably damaging 1.00
IGL02927:Tg APN 15 66,549,942 (GRCm39) missense probably damaging 1.00
IGL03061:Tg APN 15 66,543,254 (GRCm39) missense probably damaging 1.00
IGL03105:Tg APN 15 66,586,955 (GRCm39) missense probably benign 0.01
IGL03160:Tg APN 15 66,711,152 (GRCm39) nonsense probably null
IGL03242:Tg APN 15 66,555,647 (GRCm39) missense probably damaging 0.99
Also_ran UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
bedraggled UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
foster UTSW 15 66,565,109 (GRCm39) nonsense probably null
hognose UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
ito UTSW 15 66,638,011 (GRCm39) nonsense probably null
ito2 UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
ito3 UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
ito4 UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
Papua UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
Pipistrella UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
pluribus UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
samarai UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
sariba UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
ticker UTSW 15 66,699,231 (GRCm39) nonsense probably null
Vampire UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
IGL03134:Tg UTSW 15 66,612,567 (GRCm39) missense probably damaging 1.00
P0019:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
R0121:Tg UTSW 15 66,612,630 (GRCm39) missense probably benign 0.04
R0135:Tg UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
R0227:Tg UTSW 15 66,570,295 (GRCm39) missense possibly damaging 0.84
R0448:Tg UTSW 15 66,636,291 (GRCm39) missense probably damaging 1.00
R0453:Tg UTSW 15 66,700,382 (GRCm39) missense probably benign 0.09
R0504:Tg UTSW 15 66,554,253 (GRCm39) missense probably damaging 0.97
R0543:Tg UTSW 15 66,601,446 (GRCm39) missense probably benign 0.13
R0638:Tg UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
R0639:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0646:Tg UTSW 15 66,601,475 (GRCm39) missense probably damaging 0.99
R0666:Tg UTSW 15 66,609,370 (GRCm39) missense probably benign
R0673:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0689:Tg UTSW 15 66,711,253 (GRCm39) splice site probably benign
R0704:Tg UTSW 15 66,629,729 (GRCm39) missense probably benign 0.02
R0730:Tg UTSW 15 66,550,638 (GRCm39) missense probably damaging 1.00
R0830:Tg UTSW 15 66,596,993 (GRCm39) missense probably damaging 1.00
R0959:Tg UTSW 15 66,579,859 (GRCm39) missense probably damaging 0.98
R1027:Tg UTSW 15 66,544,258 (GRCm39) missense possibly damaging 0.65
R1061:Tg UTSW 15 66,570,408 (GRCm39) missense probably benign 0.09
R1086:Tg UTSW 15 66,555,911 (GRCm39) missense probably benign
R1103:Tg UTSW 15 66,591,504 (GRCm39) missense probably benign 0.45
R1240:Tg UTSW 15 66,700,397 (GRCm39) missense probably benign 0.16
R1281:Tg UTSW 15 66,568,338 (GRCm39) missense probably benign 0.34
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1531:Tg UTSW 15 66,722,351 (GRCm39) missense probably benign 0.02
R1544:Tg UTSW 15 66,577,081 (GRCm39) missense probably benign 0.04
R1550:Tg UTSW 15 66,565,279 (GRCm39) missense possibly damaging 0.52
R1575:Tg UTSW 15 66,601,534 (GRCm39) critical splice donor site probably null
R1638:Tg UTSW 15 66,568,015 (GRCm39) nonsense probably null
R1655:Tg UTSW 15 66,700,417 (GRCm39) critical splice donor site probably null
R1671:Tg UTSW 15 66,564,236 (GRCm39) missense possibly damaging 0.89
R1789:Tg UTSW 15 66,609,397 (GRCm39) missense probably benign 0.00
R1883:Tg UTSW 15 66,543,158 (GRCm39) missense probably damaging 1.00
R1984:Tg UTSW 15 66,554,691 (GRCm39) missense probably benign
R2063:Tg UTSW 15 66,700,402 (GRCm39) missense probably damaging 1.00
R2092:Tg UTSW 15 66,721,456 (GRCm39) missense probably null 0.26
R2109:Tg UTSW 15 66,601,443 (GRCm39) missense probably benign 0.02
R2128:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2129:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2207:Tg UTSW 15 66,553,788 (GRCm39) missense probably benign 0.15
R2219:Tg UTSW 15 66,553,782 (GRCm39) missense probably benign 0.03
R2228:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2229:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2259:Tg UTSW 15 66,555,747 (GRCm39) missense probably benign
R2994:Tg UTSW 15 66,553,802 (GRCm39) missense probably benign
R3904:Tg UTSW 15 66,638,011 (GRCm39) nonsense probably null
R3946:Tg UTSW 15 66,545,872 (GRCm39) missense probably damaging 1.00
R3965:Tg UTSW 15 66,556,039 (GRCm39) missense probably benign
R4245:Tg UTSW 15 66,568,318 (GRCm39) missense possibly damaging 0.68
R4451:Tg UTSW 15 66,637,996 (GRCm39) missense probably benign 0.01
R4487:Tg UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
R4489:Tg UTSW 15 66,579,791 (GRCm39) missense probably damaging 1.00
R4623:Tg UTSW 15 66,607,120 (GRCm39) missense probably benign 0.23
R4659:Tg UTSW 15 66,545,769 (GRCm39) missense possibly damaging 0.67
R4728:Tg UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
R4760:Tg UTSW 15 66,565,168 (GRCm39) missense probably damaging 1.00
R4797:Tg UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
R4944:Tg UTSW 15 66,636,186 (GRCm39) missense probably damaging 1.00
R4998:Tg UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
R5009:Tg UTSW 15 66,568,435 (GRCm39) missense probably benign 0.01
R5025:Tg UTSW 15 66,579,779 (GRCm39) missense probably damaging 1.00
R5035:Tg UTSW 15 66,553,662 (GRCm39) splice site probably null
R5049:Tg UTSW 15 66,699,231 (GRCm39) nonsense probably null
R5073:Tg UTSW 15 66,607,101 (GRCm39) missense probably benign 0.05
R5169:Tg UTSW 15 66,550,629 (GRCm39) nonsense probably null
R5185:Tg UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
R5227:Tg UTSW 15 66,631,416 (GRCm39) missense possibly damaging 0.87
R5300:Tg UTSW 15 66,550,704 (GRCm39) missense probably damaging 1.00
R5334:Tg UTSW 15 66,549,904 (GRCm39) missense probably damaging 1.00
R5339:Tg UTSW 15 66,549,942 (GRCm39) missense probably damaging 1.00
R5402:Tg UTSW 15 66,611,017 (GRCm39) missense probably damaging 0.98
R5441:Tg UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
R5509:Tg UTSW 15 66,699,142 (GRCm39) missense probably benign 0.45
R5580:Tg UTSW 15 66,557,149 (GRCm39) missense possibly damaging 0.66
R5582:Tg UTSW 15 66,565,284 (GRCm39) missense probably damaging 1.00
R5624:Tg UTSW 15 66,709,906 (GRCm39) missense probably benign 0.11
R5686:Tg UTSW 15 66,560,738 (GRCm39) missense probably benign 0.28
R6042:Tg UTSW 15 66,555,842 (GRCm39) missense probably benign 0.01
R6122:Tg UTSW 15 66,700,306 (GRCm39) missense probably damaging 1.00
R6146:Tg UTSW 15 66,545,216 (GRCm39) splice site probably null
R6159:Tg UTSW 15 66,607,096 (GRCm39) missense possibly damaging 0.71
R6223:Tg UTSW 15 66,579,771 (GRCm39) missense probably benign 0.15
R6480:Tg UTSW 15 66,543,160 (GRCm39) missense probably damaging 1.00
R6505:Tg UTSW 15 66,631,407 (GRCm39) missense probably damaging 0.99
R6531:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 0.99
R6614:Tg UTSW 15 66,607,108 (GRCm39) missense probably damaging 0.99
R6698:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 1.00
R6798:Tg UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
R6837:Tg UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
R6861:Tg UTSW 15 66,560,740 (GRCm39) missense probably benign 0.00
R6888:Tg UTSW 15 66,568,095 (GRCm39) missense probably damaging 0.99
R6933:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R7078:Tg UTSW 15 66,545,392 (GRCm39) missense probably damaging 1.00
R7244:Tg UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
R7320:Tg UTSW 15 66,566,633 (GRCm39) missense possibly damaging 0.71
R7334:Tg UTSW 15 66,597,121 (GRCm39) missense probably benign 0.01
R7418:Tg UTSW 15 66,568,432 (GRCm39) missense probably damaging 0.99
R7485:Tg UTSW 15 66,568,437 (GRCm39) missense probably benign 0.04
R7524:Tg UTSW 15 66,568,010 (GRCm39) missense probably benign 0.01
R7529:Tg UTSW 15 66,566,617 (GRCm39) missense probably damaging 0.99
R7540:Tg UTSW 15 66,561,776 (GRCm39) missense probably benign 0.16
R7583:Tg UTSW 15 66,636,267 (GRCm39) missense probably damaging 1.00
R7594:Tg UTSW 15 66,601,432 (GRCm39) missense probably benign 0.20
R7667:Tg UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
R7722:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R7790:Tg UTSW 15 66,721,453 (GRCm39) missense probably damaging 0.99
R7838:Tg UTSW 15 66,565,112 (GRCm39) missense probably benign 0.00
R7890:Tg UTSW 15 66,555,663 (GRCm39) missense probably damaging 1.00
R7904:Tg UTSW 15 66,577,128 (GRCm39) missense probably benign 0.08
R7919:Tg UTSW 15 66,555,923 (GRCm39) missense possibly damaging 0.73
R7921:Tg UTSW 15 66,555,642 (GRCm39) missense probably benign 0.08
R8037:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8038:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8214:Tg UTSW 15 66,645,247 (GRCm39) missense probably damaging 1.00
R8304:Tg UTSW 15 66,565,109 (GRCm39) nonsense probably null
R8688:Tg UTSW 15 66,566,802 (GRCm39) critical splice donor site probably benign
R8709:Tg UTSW 15 66,553,786 (GRCm39) missense probably benign 0.08
R8714:Tg UTSW 15 66,555,891 (GRCm39) missense probably damaging 0.97
R8901:Tg UTSW 15 66,557,184 (GRCm39) missense probably damaging 1.00
R8917:Tg UTSW 15 66,645,332 (GRCm39) critical splice donor site probably null
R9023:Tg UTSW 15 66,555,522 (GRCm39) missense probably damaging 1.00
R9232:Tg UTSW 15 66,570,310 (GRCm39) missense probably benign 0.01
R9310:Tg UTSW 15 66,699,118 (GRCm39) missense possibly damaging 0.69
R9361:Tg UTSW 15 66,557,246 (GRCm39) missense possibly damaging 0.50
R9389:Tg UTSW 15 66,561,173 (GRCm39) missense probably benign 0.04
R9501:Tg UTSW 15 66,718,923 (GRCm39) missense possibly damaging 0.52
R9510:Tg UTSW 15 66,545,913 (GRCm39) missense probably damaging 1.00
R9594:Tg UTSW 15 66,607,109 (GRCm39) nonsense probably null
R9629:Tg UTSW 15 66,555,587 (GRCm39) missense possibly damaging 0.95
R9701:Tg UTSW 15 66,637,991 (GRCm39) missense probably benign 0.03
R9743:Tg UTSW 15 66,561,839 (GRCm39) missense probably benign 0.18
R9748:Tg UTSW 15 66,719,008 (GRCm39) missense possibly damaging 0.91
T0975:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0005:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0065:Tg UTSW 15 66,554,303 (GRCm39) missense probably damaging 1.00
X0067:Tg UTSW 15 66,620,592 (GRCm39) missense probably benign 0.10
Z1177:Tg UTSW 15 66,721,396 (GRCm39) missense probably benign 0.02
Z1177:Tg UTSW 15 66,557,159 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GAGCACAGGTACCTTACAAGC -3'
(R):5'- ATCAGTCCAGGGTCTCAGAGAC -3'

Sequencing Primer
(F):5'- CTTACAAGCAGCTGCCTAGTAGG -3'
(R):5'- AGAGACCCCCTAGGACAGCTTG -3'
Posted On 2018-11-28