Incidental Mutation 'R6983:Tg'
ID 542810
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R6983 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 66670753-66850721 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66693358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1183 (D1183G)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000065916
AA Change: D1183G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: D1183G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,228,250 probably null Het
5730559C18Rik A G 1: 136,220,156 S353P possibly damaging Het
Abca15 T C 7: 120,354,463 V530A probably benign Het
Adgrg6 T C 10: 14,431,695 N816D probably damaging Het
Aebp2 T C 6: 140,637,663 F288L possibly damaging Het
Afdn T C 17: 13,881,321 S1024P probably damaging Het
Akap6 A C 12: 52,887,653 K643Q probably damaging Het
Atg2a A T 19: 6,260,040 D1751V probably damaging Het
Best2 T A 8: 85,009,776 I253F probably benign Het
Bmp1 G T 14: 70,508,207 P55T probably damaging Het
C1s1 C A 6: 124,540,896 V42F possibly damaging Het
Ccdc115 A G 1: 34,439,041 probably null Het
Cdc42bpg C T 19: 6,321,668 P1326S probably damaging Het
Cdhr3 G A 12: 33,042,380 T744I probably benign Het
Cit T G 5: 115,994,091 L1745R probably damaging Het
Commd6 A T 14: 101,637,052 S39T probably damaging Het
Crot T G 5: 8,978,280 Y223S probably benign Het
Crybg1 G T 10: 43,999,342 A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 E841K probably damaging Het
Dennd4c T C 4: 86,799,493 Y576H probably damaging Het
Diaph1 A T 18: 37,889,769 V749E probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
F5 A T 1: 164,194,129 D1391V probably damaging Het
Foxf2 T A 13: 31,627,197 M373K probably benign Het
Fstl1 A T 16: 37,831,618 E287D probably benign Het
Gltpd2 T C 11: 70,520,284 Y134H probably damaging Het
Hemgn T A 4: 46,395,997 H413L possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hykk T C 9: 54,946,509 S372P probably benign Het
Ints10 T C 8: 68,794,051 V11A probably damaging Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Lamtor2 G A 3: 88,552,839 Q9* probably null Het
Lonp2 T A 8: 86,624,248 V22E probably damaging Het
Mad1l1 T C 5: 140,193,984 E383G probably damaging Het
Man2b1 T A 8: 85,091,071 probably null Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Myo18a T A 11: 77,845,515 M1546K probably benign Het
Ntf3 T C 6: 126,101,845 T233A probably damaging Het
Olfr600 C T 7: 103,346,815 V38I probably benign Het
Omg T C 11: 79,501,938 S365G probably benign Het
Otol1 T A 3: 70,028,041 N455K probably damaging Het
Palm2 T A 4: 57,709,973 V306D probably damaging Het
Pde4dip A T 3: 97,718,236 Y1349N probably damaging Het
Pitpnm2 A G 5: 124,133,406 L368P probably damaging Het
Pnpla8 T A 12: 44,283,247 I194K possibly damaging Het
Podn T C 4: 108,024,273 probably null Het
Pramel6 A T 2: 87,509,579 E229V possibly damaging Het
Ptpro C T 6: 137,449,917 P262L probably damaging Het
Rnf122 A T 8: 31,118,460 T19S probably benign Het
Shank2 T A 7: 144,081,848 Y320N possibly damaging Het
Slc2a9 A C 5: 38,391,721 I243S probably damaging Het
Slc5a6 A T 5: 31,040,405 M130K probably benign Het
Stx5a A G 19: 8,755,169 probably benign Het
Tbr1 G T 2: 61,811,735 G185V probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Thbs1 A T 2: 118,119,952 I689F probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trub2 A T 2: 29,787,784 probably benign Het
Ttn A G 2: 76,766,962 V19869A probably damaging Het
Tufm T C 7: 126,489,435 V303A possibly damaging Het
Vezf1 T C 11: 88,073,319 I99T possibly damaging Het
Vmn2r1 T C 3: 64,081,697 V19A probably benign Het
Xpc C T 6: 91,504,023 R289K probably damaging Het
Zfp811 T A 17: 32,797,432 K545* probably null Het
Zmiz2 G A 11: 6,402,413 D623N probably damaging Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
Also_ran UTSW 15 66678839 missense probably damaging 1.00
bedraggled UTSW 15 66740714 missense probably damaging 1.00
foster UTSW 15 66693260 nonsense probably null
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
Pipistrella UTSW 15 66696135 missense probably damaging 1.00
pluribus UTSW 15 66715163 missense probably damaging 0.98
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
Vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
R7244:Tg UTSW 15 66740714 missense probably damaging 1.00
R7320:Tg UTSW 15 66694784 missense possibly damaging 0.71
R7334:Tg UTSW 15 66725272 missense probably benign 0.01
R7418:Tg UTSW 15 66696583 missense probably damaging 0.99
R7485:Tg UTSW 15 66696588 missense probably benign 0.04
R7524:Tg UTSW 15 66696161 missense probably benign 0.01
R7529:Tg UTSW 15 66694768 missense probably damaging 0.99
R7540:Tg UTSW 15 66689927 missense probably benign 0.16
R7583:Tg UTSW 15 66764418 missense probably damaging 1.00
R7594:Tg UTSW 15 66729583 missense probably benign 0.20
R7667:Tg UTSW 15 66715163 missense probably damaging 0.98
R7722:Tg UTSW 15 66764309 missense possibly damaging 0.73
R7790:Tg UTSW 15 66849604 missense probably damaging 0.99
R7838:Tg UTSW 15 66693263 missense probably benign 0.00
R7890:Tg UTSW 15 66683814 missense probably damaging 1.00
R7904:Tg UTSW 15 66705279 missense probably benign 0.08
R7919:Tg UTSW 15 66684074 missense possibly damaging 0.73
R7921:Tg UTSW 15 66683793 missense probably benign 0.08
R8037:Tg UTSW 15 66688875 missense probably benign 0.00
R8038:Tg UTSW 15 66688875 missense probably benign 0.00
R8214:Tg UTSW 15 66773398 missense probably damaging 1.00
R8304:Tg UTSW 15 66693260 nonsense probably null
R8688:Tg UTSW 15 66694953 critical splice donor site probably benign
R8709:Tg UTSW 15 66681937 missense probably benign 0.08
R8714:Tg UTSW 15 66684042 missense probably damaging 0.97
R8901:Tg UTSW 15 66685335 missense probably damaging 1.00
R8917:Tg UTSW 15 66773483 critical splice donor site probably null
R9023:Tg UTSW 15 66683673 missense probably damaging 1.00
R9232:Tg UTSW 15 66698461 missense probably benign 0.01
R9310:Tg UTSW 15 66827269 missense possibly damaging 0.69
R9361:Tg UTSW 15 66685397 missense possibly damaging 0.50
R9389:Tg UTSW 15 66689324 missense probably benign 0.04
R9501:Tg UTSW 15 66847074 missense possibly damaging 0.52
R9510:Tg UTSW 15 66674064 missense probably damaging 1.00
R9594:Tg UTSW 15 66735260 nonsense probably null
R9629:Tg UTSW 15 66683738 missense possibly damaging 0.95
R9701:Tg UTSW 15 66766142 missense probably benign 0.03
R9743:Tg UTSW 15 66689990 missense probably benign 0.18
R9748:Tg UTSW 15 66847159 missense possibly damaging 0.91
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Z1177:Tg UTSW 15 66685310 missense possibly damaging 0.49
Z1177:Tg UTSW 15 66849547 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGCACAGGTACCTTACAAGC -3'
(R):5'- ATCAGTCCAGGGTCTCAGAGAC -3'

Sequencing Primer
(F):5'- CTTACAAGCAGCTGCCTAGTAGG -3'
(R):5'- AGAGACCCCCTAGGACAGCTTG -3'
Posted On 2018-11-28