Incidental Mutation 'R6983:Atg2a'
ID542817
Institutional Source Beutler Lab
Gene Symbol Atg2a
Ensembl Gene ENSMUSG00000024773
Gene Nameautophagy related 2A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R6983 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6241668-6262335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6260040 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1751 (D1751V)
Ref Sequence ENSEMBL: ENSMUSP00000046412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045351]
Predicted Effect probably damaging
Transcript: ENSMUST00000045351
AA Change: D1751V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: D1751V

DomainStartEndE-ValueType
Pfam:Chorein_N 14 131 7.6e-20 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 501 512 N/A INTRINSIC
low complexity region 852 863 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
low complexity region 1429 1446 N/A INTRINSIC
low complexity region 1761 1773 N/A INTRINSIC
Pfam:ATG_C 1814 1908 2.2e-31 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773
AA Change: D1554V

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 871 883 N/A INTRINSIC
low complexity region 1233 1250 N/A INTRINSIC
low complexity region 1565 1577 N/A INTRINSIC
Pfam:ATG_C 1618 1712 3.6e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,228,250 probably null Het
5730559C18Rik A G 1: 136,220,156 S353P possibly damaging Het
Abca15 T C 7: 120,354,463 V530A probably benign Het
Adgrg6 T C 10: 14,431,695 N816D probably damaging Het
Aebp2 T C 6: 140,637,663 F288L possibly damaging Het
Afdn T C 17: 13,881,321 S1024P probably damaging Het
Akap6 A C 12: 52,887,653 K643Q probably damaging Het
Best2 T A 8: 85,009,776 I253F probably benign Het
Bmp1 G T 14: 70,508,207 P55T probably damaging Het
C1s1 C A 6: 124,540,896 V42F possibly damaging Het
Ccdc115 A G 1: 34,439,041 probably null Het
Cdc42bpg C T 19: 6,321,668 P1326S probably damaging Het
Cdhr3 G A 12: 33,042,380 T744I probably benign Het
Cit T G 5: 115,994,091 L1745R probably damaging Het
Commd6 A T 14: 101,637,052 S39T probably damaging Het
Crot T G 5: 8,978,280 Y223S probably benign Het
Crybg1 G T 10: 43,999,342 A590D probably damaging Het
Cwf19l2 G A 9: 3,477,817 E841K probably damaging Het
Dennd4c T C 4: 86,799,493 Y576H probably damaging Het
Diaph1 A T 18: 37,889,769 V749E probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
F5 A T 1: 164,194,129 D1391V probably damaging Het
Foxf2 T A 13: 31,627,197 M373K probably benign Het
Fstl1 A T 16: 37,831,618 E287D probably benign Het
Gltpd2 T C 11: 70,520,284 Y134H probably damaging Het
Hemgn T A 4: 46,395,997 H413L possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hykk T C 9: 54,946,509 S372P probably benign Het
Ints10 T C 8: 68,794,051 V11A probably damaging Het
Khdrbs1 A G 4: 129,720,842 V306A probably benign Het
Lamtor2 G A 3: 88,552,839 Q9* probably null Het
Lonp2 T A 8: 86,624,248 V22E probably damaging Het
Mad1l1 T C 5: 140,193,984 E383G probably damaging Het
Man2b1 T A 8: 85,091,071 probably null Het
Mtch1 T C 17: 29,338,776 I243V probably damaging Het
Myo18a T A 11: 77,845,515 M1546K probably benign Het
Ntf3 T C 6: 126,101,845 T233A probably damaging Het
Olfr600 C T 7: 103,346,815 V38I probably benign Het
Omg T C 11: 79,501,938 S365G probably benign Het
Otol1 T A 3: 70,028,041 N455K probably damaging Het
Palm2 T A 4: 57,709,973 V306D probably damaging Het
Pde4dip A T 3: 97,718,236 Y1349N probably damaging Het
Pitpnm2 A G 5: 124,133,406 L368P probably damaging Het
Pnpla8 T A 12: 44,283,247 I194K possibly damaging Het
Podn T C 4: 108,024,273 probably null Het
Pramel6 A T 2: 87,509,579 E229V possibly damaging Het
Ptpro C T 6: 137,449,917 P262L probably damaging Het
Rnf122 A T 8: 31,118,460 T19S probably benign Het
Shank2 T A 7: 144,081,848 Y320N possibly damaging Het
Slc2a9 A C 5: 38,391,721 I243S probably damaging Het
Slc5a6 A T 5: 31,040,405 M130K probably benign Het
Stx5a A G 19: 8,755,169 probably benign Het
Tbr1 G T 2: 61,811,735 G185V probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Tg A G 15: 66,693,358 D1183G probably benign Het
Thbs1 A T 2: 118,119,952 I689F probably damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trub2 A T 2: 29,787,784 probably benign Het
Ttn A G 2: 76,766,962 V19869A probably damaging Het
Tufm T C 7: 126,489,435 V303A possibly damaging Het
Vezf1 T C 11: 88,073,319 I99T possibly damaging Het
Vmn2r1 T C 3: 64,081,697 V19A probably benign Het
Xpc C T 6: 91,504,023 R289K probably damaging Het
Zfp811 T A 17: 32,797,432 K545* probably null Het
Zmiz2 G A 11: 6,402,413 D623N probably damaging Het
Other mutations in Atg2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Atg2a APN 19 6254599 missense probably damaging 1.00
IGL01612:Atg2a APN 19 6252484 missense probably benign 0.03
IGL02105:Atg2a APN 19 6250403 splice site probably benign
IGL02151:Atg2a APN 19 6255757 missense possibly damaging 0.95
IGL02228:Atg2a APN 19 6246800 missense probably benign 0.29
IGL02329:Atg2a APN 19 6249929 critical splice donor site probably null
IGL02408:Atg2a APN 19 6241828 nonsense probably null
IGL02538:Atg2a APN 19 6257628 missense probably benign
IGL02830:Atg2a APN 19 6247681 missense probably benign 0.04
IGL03349:Atg2a APN 19 6258024 missense possibly damaging 0.77
PIT4515001:Atg2a UTSW 19 6253585 missense probably damaging 1.00
R0099:Atg2a UTSW 19 6252789 missense probably damaging 0.97
R0212:Atg2a UTSW 19 6246554 missense probably damaging 1.00
R0365:Atg2a UTSW 19 6247683 missense possibly damaging 0.51
R0398:Atg2a UTSW 19 6246578 missense probably damaging 1.00
R0483:Atg2a UTSW 19 6256601 missense probably damaging 0.98
R0483:Atg2a UTSW 19 6256602 missense probably benign 0.01
R0494:Atg2a UTSW 19 6253377 missense probably damaging 1.00
R0511:Atg2a UTSW 19 6252539 missense possibly damaging 0.89
R0590:Atg2a UTSW 19 6245007 unclassified probably benign
R0592:Atg2a UTSW 19 6245007 unclassified probably benign
R0593:Atg2a UTSW 19 6245007 unclassified probably benign
R0630:Atg2a UTSW 19 6244517 missense probably damaging 0.99
R1306:Atg2a UTSW 19 6253021 missense probably benign 0.31
R1437:Atg2a UTSW 19 6250616 missense probably damaging 1.00
R1539:Atg2a UTSW 19 6246771 splice site probably null
R1774:Atg2a UTSW 19 6250598 missense probably benign 0.01
R1781:Atg2a UTSW 19 6256213 missense probably damaging 0.96
R1854:Atg2a UTSW 19 6252431 missense probably benign 0.11
R1884:Atg2a UTSW 19 6254384 missense probably damaging 1.00
R1899:Atg2a UTSW 19 6245067 missense probably damaging 1.00
R1935:Atg2a UTSW 19 6252536 missense probably damaging 1.00
R2020:Atg2a UTSW 19 6250269 critical splice donor site probably null
R2071:Atg2a UTSW 19 6257458 missense probably benign 0.00
R2513:Atg2a UTSW 19 6258046 critical splice donor site probably null
R3808:Atg2a UTSW 19 6252816 missense possibly damaging 0.71
R4065:Atg2a UTSW 19 6258366 missense probably damaging 1.00
R4109:Atg2a UTSW 19 6258374 missense possibly damaging 0.95
R4352:Atg2a UTSW 19 6257457 missense probably benign 0.04
R4440:Atg2a UTSW 19 6255829 critical splice donor site probably null
R4472:Atg2a UTSW 19 6258955 missense probably damaging 0.98
R4669:Atg2a UTSW 19 6258987 critical splice donor site probably null
R4878:Atg2a UTSW 19 6250244 missense probably damaging 1.00
R4926:Atg2a UTSW 19 6257533 missense probably damaging 0.96
R5237:Atg2a UTSW 19 6246814 missense probably benign
R5350:Atg2a UTSW 19 6251338 missense probably damaging 0.99
R5507:Atg2a UTSW 19 6245070 missense possibly damaging 0.94
R5732:Atg2a UTSW 19 6257460 missense probably damaging 1.00
R5784:Atg2a UTSW 19 6261505 missense probably damaging 1.00
R5960:Atg2a UTSW 19 6254360 missense probably damaging 1.00
R5985:Atg2a UTSW 19 6254637 missense probably damaging 1.00
R6175:Atg2a UTSW 19 6241729 unclassified probably benign
R6572:Atg2a UTSW 19 6254665 missense probably damaging 0.98
R6878:Atg2a UTSW 19 6250178 missense probably damaging 0.99
R6879:Atg2a UTSW 19 6251852 missense possibly damaging 0.70
R7024:Atg2a UTSW 19 6250219 missense possibly damaging 0.88
R7217:Atg2a UTSW 19 6253441 critical splice donor site probably null
R7384:Atg2a UTSW 19 6261677 missense probably damaging 1.00
R7387:Atg2a UTSW 19 6255168 missense possibly damaging 0.79
R7425:Atg2a UTSW 19 6255652 missense probably benign 0.02
R7512:Atg2a UTSW 19 6260076 missense probably damaging 1.00
R7658:Atg2a UTSW 19 6251263 missense probably damaging 1.00
R7893:Atg2a UTSW 19 6251296 missense probably damaging 1.00
R8062:Atg2a UTSW 19 6252579 critical splice donor site probably null
R8258:Atg2a UTSW 19 6249829 missense probably damaging 0.98
R8259:Atg2a UTSW 19 6249829 missense probably damaging 0.98
R8350:Atg2a UTSW 19 6246811 missense probably benign 0.03
R8412:Atg2a UTSW 19 6244524 missense probably damaging 1.00
R8450:Atg2a UTSW 19 6246811 missense probably benign 0.03
R8474:Atg2a UTSW 19 6251403 critical splice donor site probably null
R8501:Atg2a UTSW 19 6254390 missense probably damaging 1.00
R8738:Atg2a UTSW 19 6256644 missense probably benign 0.00
R8786:Atg2a UTSW 19 6244430 missense probably damaging 1.00
R8810:Atg2a UTSW 19 6250621 missense probably benign 0.01
X0065:Atg2a UTSW 19 6258196 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GAGGACTTTTGAAATTGCACTTGG -3'
(R):5'- CAAGTTTCGGCTTTCAGGGG -3'

Sequencing Primer
(F):5'- CAGCATGGTCTACAAAGTGAGTTCC -3'
(R):5'- CAGGGGGACTGTGCAGAC -3'
Posted On2018-11-28