Incidental Mutation 'R6984:Med24'
ID542854
Institutional Source Beutler Lab
Gene Symbol Med24
Ensembl Gene ENSMUSG00000017210
Gene Namemediator complex subunit 24
SynonymsTrap100, 100kDa, Thrap4, Pparb2, R75526, DRIP100, Gse2, D11Ertd307e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98704591-98729435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98718542 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000098069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017354] [ENSMUST00000100500] [ENSMUST00000126565] [ENSMUST00000138750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017354
AA Change: V94A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017354
Gene: ENSMUSG00000017210
AA Change: V94A

DomainStartEndE-ValueType
Pfam:Med24_N 1 985 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100500
AA Change: V94A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098069
Gene: ENSMUSG00000017210
AA Change: V94A

DomainStartEndE-ValueType
Pfam:Med24_N 1 1004 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126565
SMART Domains Protein: ENSMUSP00000118820
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 90 5.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138750
SMART Domains Protein: ENSMUSP00000120002
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 46 1.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene may form a submodule of the mediator complex that magnifies the effects of activators on the general transcription machinery. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die prior to birth exhibiting abnormal heart development, neural tube defects, and anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
3425401B19Rik A G 14: 32,661,980 V676A probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Aktip A T 8: 91,126,718 F124I probably damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Asb15 A T 6: 24,566,337 I430F probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Lrrc4b A T 7: 44,461,298 E198V possibly damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Mapk8ip1 A T 2: 92,386,727 S417T probably damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rhot1 T A 11: 80,233,484 C157* probably null Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Sympk A G 7: 19,038,043 D344G probably benign Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in Med24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Med24 APN 11 98709682 missense probably damaging 0.99
IGL01960:Med24 APN 11 98707542 missense probably benign
IGL02119:Med24 APN 11 98728835 missense probably benign 0.14
IGL02681:Med24 APN 11 98709739 nonsense probably null
IGL03038:Med24 APN 11 98716184 missense possibly damaging 0.93
IGL03377:Med24 APN 11 98705136 missense possibly damaging 0.67
R1186:Med24 UTSW 11 98717757 utr 3 prime probably benign
R1887:Med24 UTSW 11 98718816 critical splice donor site probably benign
R1888:Med24 UTSW 11 98707282 utr 3 prime probably benign
R1936:Med24 UTSW 11 98718816 critical splice donor site probably null
R2063:Med24 UTSW 11 98715646 missense probably damaging 0.98
R3895:Med24 UTSW 11 98706388 missense probably benign
R4328:Med24 UTSW 11 98707116 critical splice donor site probably null
R4751:Med24 UTSW 11 98706432 missense probably damaging 0.98
R5195:Med24 UTSW 11 98710281 missense possibly damaging 0.71
R5237:Med24 UTSW 11 98710783 missense probably damaging 0.98
R6047:Med24 UTSW 11 98707765 nonsense probably null
R6834:Med24 UTSW 11 98705024 splice site probably null
R7015:Med24 UTSW 11 98718852 missense possibly damaging 0.51
R7244:Med24 UTSW 11 98714397 splice site probably null
R7479:Med24 UTSW 11 98704961 missense possibly damaging 0.52
R7536:Med24 UTSW 11 98712621 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TTTGTCTTAAGGAAACAGAAGCTGG -3'
(R):5'- GGGCAAATAAGGCTACCAGC -3'

Sequencing Primer
(F):5'- TCTTAAGGAAACAGAAGCTGGAGGTG -3'
(R):5'- TCAGGTCATGTGTCCCCTGAG -3'
Posted On2018-11-28