Incidental Mutation 'R6984:Ell2'
ID542860
Institutional Source Beutler Lab
Gene Symbol Ell2
Ensembl Gene ENSMUSG00000001542
Gene Nameelongation factor RNA polymerase II 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location75706757-75772364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75761887 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 119 (L119M)
Ref Sequence ENSEMBL: ENSMUSP00000152427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001583] [ENSMUST00000220572] [ENSMUST00000222194] [ENSMUST00000222853]
Predicted Effect probably damaging
Transcript: ENSMUST00000001583
AA Change: L251M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001583
Gene: ENSMUSG00000001542
AA Change: L251M

DomainStartEndE-ValueType
Pfam:ELL 11 291 2.4e-108 PFAM
low complexity region 362 401 N/A INTRINSIC
low complexity region 451 476 N/A INTRINSIC
Pfam:Occludin_ELL 531 632 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220572
Predicted Effect probably benign
Transcript: ENSMUST00000222194
Predicted Effect probably damaging
Transcript: ENSMUST00000222853
AA Change: L119M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
3425401B19Rik A G 14: 32,661,980 V676A probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Aktip A T 8: 91,126,718 F124I probably damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Asb15 A T 6: 24,566,337 I430F probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Lrrc4b A T 7: 44,461,298 E198V possibly damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Mapk8ip1 A T 2: 92,386,727 S417T probably damaging Het
Med24 A G 11: 98,718,542 V94A possibly damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rhot1 T A 11: 80,233,484 C157* probably null Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Sympk A G 7: 19,038,043 D344G probably benign Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in Ell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ell2 APN 13 75756290 missense probably damaging 1.00
IGL01315:Ell2 APN 13 75762232 unclassified probably benign
IGL01446:Ell2 APN 13 75761991 missense probably benign 0.02
IGL02691:Ell2 APN 13 75756486 missense probably damaging 0.97
IGL02963:Ell2 APN 13 75769643 missense possibly damaging 0.48
IGL03035:Ell2 APN 13 75763648 nonsense probably null
PIT4469001:Ell2 UTSW 13 75761892 missense probably damaging 0.99
R0123:Ell2 UTSW 13 75762140 splice site probably benign
R0321:Ell2 UTSW 13 75761888 missense probably damaging 1.00
R0594:Ell2 UTSW 13 75749993 missense probably damaging 1.00
R0892:Ell2 UTSW 13 75763639 missense probably damaging 0.97
R1078:Ell2 UTSW 13 75746419 splice site probably benign
R1696:Ell2 UTSW 13 75769558 missense probably damaging 1.00
R2325:Ell2 UTSW 13 75769626 missense probably damaging 1.00
R2886:Ell2 UTSW 13 75763785 missense probably damaging 1.00
R3760:Ell2 UTSW 13 75762162 missense probably benign 0.37
R4206:Ell2 UTSW 13 75761948 missense probably damaging 1.00
R4632:Ell2 UTSW 13 75769574 missense possibly damaging 0.84
R5068:Ell2 UTSW 13 75763618 missense probably benign 0.00
R6980:Ell2 UTSW 13 75756376 missense probably null
R6983:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R6986:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7073:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7074:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7473:Ell2 UTSW 13 75750035 missense probably damaging 1.00
Z1088:Ell2 UTSW 13 75761873 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGGTAAACATATGAAGCAACCTGAG -3'
(R):5'- TCGTTTCCACCTCAACAGTCAAA -3'

Sequencing Primer
(F):5'- CTTTATGCACACATGTAGCAGAGG -3'
(R):5'- GTCAAACAACACTTATTTGCACC -3'
Posted On2018-11-28