Incidental Mutation 'R6984:3425401B19Rik'
ID542861
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6984 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32661980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 676 (V676A)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect probably benign
Transcript: ENSMUST00000096038
AA Change: V676A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: V676A

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik G A 18: 40,257,048 probably benign Het
Abcb5 A G 12: 118,927,277 M495T possibly damaging Het
Aktip A T 8: 91,126,718 F124I probably damaging Het
Alpk2 C A 18: 65,305,678 Q1348H possibly damaging Het
Apol11b T C 15: 77,635,346 D178G probably benign Het
Asb15 A T 6: 24,566,337 I430F probably benign Het
Chd2 A C 7: 73,484,411 Y729* probably null Het
Cpb2 T C 14: 75,265,458 V159A possibly damaging Het
Csf2rb A G 15: 78,345,519 S429G probably damaging Het
Ctsw C T 19: 5,466,618 R133H probably damaging Het
Dhx30 A G 9: 110,091,417 probably null Het
Dnah8 G A 17: 30,739,738 G2185R probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enthd1 A T 15: 80,560,108 I82N probably damaging Het
Epx T A 11: 87,868,598 D555V probably damaging Het
Fhdc1 T G 3: 84,444,516 D1134A possibly damaging Het
Fip1l1 T A 5: 74,542,073 V82D probably damaging Het
Fn1 A T 1: 71,626,079 F960I probably damaging Het
Gm13212 T C 4: 145,620,616 L30P probably damaging Het
Gsdmc2 A T 15: 63,825,049 Y424* probably null Het
Hsd3b7 T A 7: 127,801,545 I57N probably damaging Het
Ighv10-1 A T 12: 114,479,082 D94E possibly damaging Het
Ighv3-3 A G 12: 114,196,730 V20A possibly damaging Het
Kcnh3 G T 15: 99,228,552 C220F probably benign Het
L3mbtl3 T C 10: 26,282,855 K632E unknown Het
Lama1 G A 17: 67,779,112 V1449M Het
Lgr6 A G 1: 134,988,002 I336T possibly damaging Het
Lrp1b A C 2: 40,822,628 D3117E probably damaging Het
Lrrc4b A T 7: 44,461,298 E198V possibly damaging Het
Map2 A T 1: 66,415,236 D1095V possibly damaging Het
Mapk8ip1 A T 2: 92,386,727 S417T probably damaging Het
Med24 A G 11: 98,718,542 V94A possibly damaging Het
Megf11 A G 9: 64,686,452 I637V probably benign Het
Mpp7 C T 18: 7,441,623 G182D probably damaging Het
Myh15 G A 16: 49,110,412 G583D probably damaging Het
Naa15 A G 3: 51,472,600 T750A probably benign Het
Olfr1417 T A 19: 11,828,304 T241S probably damaging Het
Olfr390 G A 11: 73,787,777 V280M possibly damaging Het
Olfr977-ps1 C T 9: 39,974,734 V30I unknown Het
Pgm2 A T 4: 99,929,654 Q30L probably benign Het
Pi4kb C T 3: 94,996,934 R238C probably damaging Het
Plec T C 15: 76,175,327 E3497G probably damaging Het
Plpp4 C T 7: 129,390,892 A218V possibly damaging Het
Plxnc1 G A 10: 94,831,530 A1094V probably damaging Het
Pom121l2 A T 13: 21,982,021 D154V probably benign Het
Prrt4 G T 6: 29,171,430 P341Q probably benign Het
Psd3 A G 8: 67,818,045 V21A possibly damaging Het
Rhot1 T A 11: 80,233,484 C157* probably null Het
Rnase9 C T 14: 51,039,216 V102M probably benign Het
Rpgrip1l A C 8: 91,260,798 M877R probably benign Het
Ryr3 T C 2: 112,875,091 Y806C probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Sympk A G 7: 19,038,043 D344G probably benign Het
Tcf12 G A 9: 72,006,759 Q76* probably null Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Ttc19 A G 11: 62,314,037 Y318C probably damaging Het
Vmn2r17 T A 5: 109,452,667 D610E probably benign Het
Wdr24 A G 17: 25,828,235 T701A possibly damaging Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCACCTGCACTCACATGG -3'
(R):5'- TGTCAATGGGGAAGCTGCAG -3'

Sequencing Primer
(F):5'- GGGCCTTCTGTAAAGCATACC -3'
(R):5'- AGCTGCAGAAAGTAACAGTAATG -3'
Posted On2018-11-28