Incidental Mutation 'R6985:Sstr4'
ID 542890
Institutional Source Beutler Lab
Gene Symbol Sstr4
Ensembl Gene ENSMUSG00000037014
Gene Name somatostatin receptor 4
Synonyms Smstr4, sst4
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R6985 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 148395344-148396767 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 148396249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 260 (M260K)
Ref Sequence ENSEMBL: ENSMUSP00000105588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109962]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109962
AA Change: M260K

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105588
Gene: ENSMUSG00000037014
AA Change: M260K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 55 323 4.7e-16 PFAM
Pfam:7tm_1 61 308 2.2e-61 PFAM
Pfam:7TM_GPCR_Srv 117 325 1.8e-10 PFAM
Pfam:7TM_GPCR_Srw 203 326 8.1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have increased susceptibility to inflammation, delayed type hypersensitivity, hyperalgesia and airway hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Sstr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Sstr4 APN 2 148395552 missense probably benign 0.00
IGL01536:Sstr4 APN 2 148395880 missense probably damaging 1.00
IGL02210:Sstr4 APN 2 148396309 missense probably damaging 1.00
IGL02670:Sstr4 APN 2 148396533 nonsense probably null
R0396:Sstr4 UTSW 2 148396261 missense probably damaging 1.00
R1428:Sstr4 UTSW 2 148396359 missense probably benign 0.01
R1839:Sstr4 UTSW 2 148395533 missense probably benign 0.21
R2332:Sstr4 UTSW 2 148396410 missense probably damaging 1.00
R2943:Sstr4 UTSW 2 148396165 missense probably damaging 0.96
R3700:Sstr4 UTSW 2 148396353 missense possibly damaging 0.57
R5502:Sstr4 UTSW 2 148395551 small insertion probably benign
R5503:Sstr4 UTSW 2 148395551 small insertion probably benign
R5596:Sstr4 UTSW 2 148395732 missense possibly damaging 0.65
R5726:Sstr4 UTSW 2 148396083 missense probably damaging 1.00
R8939:Sstr4 UTSW 2 148396308 missense probably damaging 1.00
R8943:Sstr4 UTSW 2 148395862 missense possibly damaging 0.94
X0022:Sstr4 UTSW 2 148395532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCGCAGTCTTCGCTGACAC -3'
(R):5'- TGTTTCCAGGAGACAGCAGC -3'

Sequencing Primer
(F):5'- AGTCTTCGCTGACACCAGGC -3'
(R):5'- AGGCACAGAACCCGCTG -3'
Posted On 2018-11-28