Incidental Mutation 'R6985:Olfr619'
ID542904
Institutional Source Beutler Lab
Gene Symbol Olfr619
Ensembl Gene ENSMUSG00000073944
Gene Nameolfactory receptor 619
SynonymsMOR31-5, GA_x6K02T2PBJ9-6326488-6327450
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103600575-103604859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103603668 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 5 (T5A)
Ref Sequence ENSEMBL: ENSMUSP00000150630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098196] [ENSMUST00000214883] [ENSMUST00000215732] [ENSMUST00000217603]
Predicted Effect probably benign
Transcript: ENSMUST00000098196
AA Change: T5A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095798
Gene: ENSMUSG00000073944
AA Change: T5A

DomainStartEndE-ValueType
Pfam:7tm_4 36 316 4.4e-106 PFAM
Pfam:7TM_GPCR_Srsx 40 265 5e-10 PFAM
Pfam:7tm_1 46 298 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214883
Predicted Effect probably benign
Transcript: ENSMUST00000215732
AA Change: T5A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217603
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Olfr619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Olfr619 APN 7 103604067 missense probably benign 0.23
IGL01806:Olfr619 APN 7 103604341 missense probably benign 0.21
IGL01934:Olfr619 APN 7 103603975 missense probably damaging 1.00
IGL02269:Olfr619 APN 7 103603882 missense probably damaging 0.98
IGL03049:Olfr619 APN 7 103604091 missense probably damaging 0.99
IGL03165:Olfr619 APN 7 103604011 missense probably damaging 0.98
IGL03338:Olfr619 APN 7 103604408 nonsense probably null
R1378:Olfr619 UTSW 7 103603938 nonsense probably null
R1660:Olfr619 UTSW 7 103603675 nonsense probably null
R1975:Olfr619 UTSW 7 103604012 unclassified probably null
R1985:Olfr619 UTSW 7 103603672 missense probably benign
R2249:Olfr619 UTSW 7 103603736 missense probably benign 0.00
R2423:Olfr619 UTSW 7 103604034 missense probably benign 0.14
R4005:Olfr619 UTSW 7 103604263 missense probably damaging 1.00
R4931:Olfr619 UTSW 7 103604374 missense probably benign 0.01
R4939:Olfr619 UTSW 7 103604251 missense probably benign 0.12
R4942:Olfr619 UTSW 7 103604194 missense probably benign
R4970:Olfr619 UTSW 7 103603990 missense probably damaging 0.98
R4993:Olfr619 UTSW 7 103603656 start codon destroyed probably benign 0.01
R5254:Olfr619 UTSW 7 103603789 missense probably benign 0.19
R6001:Olfr619 UTSW 7 103603972 missense probably damaging 1.00
R6905:Olfr619 UTSW 7 103604367 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAATCAGGTAAAAGCATTTCAC -3'
(R):5'- ATGGGTTCATGAAGACTATGCTC -3'

Sequencing Primer
(F):5'- CAGGTAAAAGCATTTCACAGACTTTC -3'
(R):5'- GGGTTCATGAAGACTATGCTCAATAG -3'
Posted On2018-11-28