Incidental Mutation 'R6985:Cnot1'
ID542911
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95734129 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1755 (N1755S)
Ref Sequence ENSEMBL: ENSMUSP00000096073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect probably benign
Transcript: ENSMUST00000068452
AA Change: N1750S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: N1750S

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: N1755S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: N1755S

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: N1748S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
barge UTSW 8 95734129 missense probably benign 0.13
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7940:Cnot1 UTSW 8 95745647 frame shift probably null
R8004:Cnot1 UTSW 8 95752752 missense not run
R8061:Cnot1 UTSW 8 95765027 missense not run
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense not run
Predicted Primers PCR Primer
(F):5'- CAGGAGAGCAGAGCACTTCATTC -3'
(R):5'- AGGTGCCTAATTGAATGTCGAGATG -3'

Sequencing Primer
(F):5'- GAGAGCAGAGCACTTCATTCTTACC -3'
(R):5'- AATATAATGTGGAGGCTGTGGAATTG -3'
Posted On2018-11-28