Incidental Mutation 'R6985:Slc35f1'
ID 542914
Institutional Source Beutler Lab
Gene Symbol Slc35f1
Ensembl Gene ENSMUSG00000038602
Gene Name solute carrier family 35, member F1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6985 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 52690533-53111622 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 53021911 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 139 (D139E)
Ref Sequence ENSEMBL: ENSMUSP00000101113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105473]
AlphaFold Q8BGK5
Predicted Effect probably benign
Transcript: ENSMUST00000105473
AA Change: D139E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101113
Gene: ENSMUSG00000038602
AA Change: D139E

low complexity region 3 20 N/A INTRINSIC
Pfam:SLC35F 56 355 1.4e-151 PFAM
Pfam:CRT-like 66 315 2.3e-13 PFAM
Pfam:EamA 217 355 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Slc35f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc35f1 APN 10 53062452 missense probably damaging 1.00
IGL01073:Slc35f1 APN 10 53021960 missense probably benign 0.16
IGL01433:Slc35f1 APN 10 53073446 splice site probably benign
IGL01566:Slc35f1 APN 10 53089455 missense probably damaging 1.00
IGL02693:Slc35f1 APN 10 52933128 missense probably damaging 1.00
IGL02870:Slc35f1 APN 10 52933207 missense possibly damaging 0.82
IGL03082:Slc35f1 APN 10 52933138 missense probably benign
R0884:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R1340:Slc35f1 UTSW 10 53089454 missense probably damaging 1.00
R1781:Slc35f1 UTSW 10 53062436 splice site probably null
R1813:Slc35f1 UTSW 10 52933195 missense probably damaging 1.00
R1908:Slc35f1 UTSW 10 53021904 missense possibly damaging 0.84
R2044:Slc35f1 UTSW 10 53089347 missense probably damaging 1.00
R2518:Slc35f1 UTSW 10 53073534 missense probably benign 0.07
R3872:Slc35f1 UTSW 10 53021910 missense possibly damaging 0.87
R3934:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R3935:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R3936:Slc35f1 UTSW 10 53108218 missense probably damaging 1.00
R4118:Slc35f1 UTSW 10 53089368 missense probably damaging 0.98
R4921:Slc35f1 UTSW 10 53062602 missense probably damaging 0.99
R5116:Slc35f1 UTSW 10 53021895 missense probably benign 0.39
R5378:Slc35f1 UTSW 10 52691061 missense possibly damaging 0.86
R5387:Slc35f1 UTSW 10 53108164 missense probably damaging 1.00
R5500:Slc35f1 UTSW 10 52933222 missense probably damaging 0.99
R5590:Slc35f1 UTSW 10 53108178 missense possibly damaging 0.63
R5743:Slc35f1 UTSW 10 53089450 missense probably benign 0.06
R5916:Slc35f1 UTSW 10 52933221 nonsense probably null
R7068:Slc35f1 UTSW 10 53062500 missense probably damaging 1.00
R7295:Slc35f1 UTSW 10 53062541 missense probably benign 0.00
R7427:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
R7428:Slc35f1 UTSW 10 53089414 missense probably damaging 1.00
R8334:Slc35f1 UTSW 10 53108148 missense possibly damaging 0.84
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gtcaagaacttcagccattt -3'
Posted On 2018-11-28