Incidental Mutation 'R6985:Nrxn2'
ID542943
Institutional Source Beutler Lab
Gene Symbol Nrxn2
Ensembl Gene ENSMUSG00000033768
Gene Nameneurexin II
Synonyms6430591O13Rik, neurexin II beta, neurexin II alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6985 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6418731-6544169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6481245 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 645 (V645E)
Ref Sequence ENSEMBL: ENSMUSP00000119762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113461] [ENSMUST00000113462] [ENSMUST00000137166]
Predicted Effect probably damaging
Transcript: ENSMUST00000077182
AA Change: V630E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768
AA Change: V630E

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 444 1.18e-33 SMART
LamG 498 651 1.51e-40 SMART
EGF 678 712 8.91e-3 SMART
LamG 737 875 4.91e-22 SMART
LamG 923 1059 1.08e-41 SMART
EGF 1084 1118 1.91e1 SMART
LamG 1146 1303 4.48e-16 SMART
low complexity region 1332 1362 N/A INTRINSIC
low complexity region 1430 1445 N/A INTRINSIC
4.1m 1448 1466 3.75e-4 SMART
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113461
AA Change: V614E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109088
Gene: ENSMUSG00000033768
AA Change: V614E

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
LamG 286 428 8.4e-30 SMART
LamG 482 635 1.51e-40 SMART
EGF 662 696 8.91e-3 SMART
LamG 721 850 2.36e-24 SMART
LamG 898 1034 1.08e-41 SMART
EGF 1059 1093 1.91e1 SMART
LamG 1121 1248 1.26e-19 SMART
low complexity region 1277 1307 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
low complexity region 1567 1582 N/A INTRINSIC
4.1m 1585 1603 3.75e-4 SMART
low complexity region 1617 1636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113462
AA Change: V638E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768
AA Change: V638E

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 452 8.4e-30 SMART
LamG 506 659 1.51e-40 SMART
EGF 686 720 8.91e-3 SMART
LamG 745 883 4.91e-22 SMART
LamG 931 1067 1.08e-41 SMART
EGF 1092 1126 1.91e1 SMART
LamG 1154 1311 4.48e-16 SMART
low complexity region 1340 1370 N/A INTRINSIC
low complexity region 1426 1447 N/A INTRINSIC
low complexity region 1630 1645 N/A INTRINSIC
4.1m 1648 1666 3.75e-4 SMART
low complexity region 1680 1699 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137166
AA Change: V645E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768
AA Change: V645E

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 459 8.87e-29 SMART
LamG 513 666 1.51e-40 SMART
EGF 693 727 8.91e-3 SMART
LamG 752 890 4.91e-22 SMART
LamG 938 1074 1.08e-41 SMART
EGF 1099 1133 1.91e1 SMART
LamG 1161 1318 4.48e-16 SMART
low complexity region 1347 1377 N/A INTRINSIC
low complexity region 1433 1454 N/A INTRINSIC
low complexity region 1637 1652 N/A INTRINSIC
4.1m 1655 1673 3.75e-4 SMART
low complexity region 1687 1706 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are generally non-viable; surviving homozygotes show a 30-40% decrease in body weight and their inhibitory postsynaptic currents (IPSCs) are decreased in cortical slice cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Ctsh G A 9: 90,054,604 A19T possibly damaging Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Nrxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nrxn2 APN 19 6473593 missense possibly damaging 0.84
IGL01020:Nrxn2 APN 19 6493443 missense probably benign 0.02
IGL01064:Nrxn2 APN 19 6517053 missense probably damaging 0.97
IGL01561:Nrxn2 APN 19 6490142 missense probably damaging 1.00
IGL01759:Nrxn2 APN 19 6509929 missense probably damaging 1.00
IGL02071:Nrxn2 APN 19 6481753 missense probably damaging 1.00
IGL02085:Nrxn2 APN 19 6492868 missense possibly damaging 0.83
IGL02132:Nrxn2 APN 19 6472276 missense probably damaging 1.00
IGL02476:Nrxn2 APN 19 6454985 missense probably damaging 1.00
IGL02605:Nrxn2 APN 19 6450580 missense probably benign 0.02
IGL03123:Nrxn2 APN 19 6481737 missense probably damaging 0.98
IGL03288:Nrxn2 APN 19 6490696 missense probably damaging 1.00
PIT4687001:Nrxn2 UTSW 19 6481308 missense probably benign 0.06
R0019:Nrxn2 UTSW 19 6509957 splice site probably benign
R0257:Nrxn2 UTSW 19 6490698 missense possibly damaging 0.81
R0305:Nrxn2 UTSW 19 6519283 missense probably damaging 1.00
R0453:Nrxn2 UTSW 19 6491521 missense probably damaging 1.00
R0512:Nrxn2 UTSW 19 6517198 missense probably damaging 1.00
R0539:Nrxn2 UTSW 19 6493404 missense probably damaging 0.99
R0571:Nrxn2 UTSW 19 6473533 missense probably damaging 1.00
R1373:Nrxn2 UTSW 19 6472301 missense probably damaging 1.00
R1434:Nrxn2 UTSW 19 6443612 splice site probably null
R1454:Nrxn2 UTSW 19 6481446 missense probably damaging 0.98
R1671:Nrxn2 UTSW 19 6473750 missense probably damaging 1.00
R1692:Nrxn2 UTSW 19 6519268 missense probably damaging 1.00
R1858:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R1859:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R2153:Nrxn2 UTSW 19 6504914 missense probably damaging 1.00
R2196:Nrxn2 UTSW 19 6490109 missense probably damaging 1.00
R2209:Nrxn2 UTSW 19 6493007 missense probably benign 0.01
R2278:Nrxn2 UTSW 19 6481853 missense probably damaging 1.00
R2441:Nrxn2 UTSW 19 6428301 missense probably damaging 1.00
R3897:Nrxn2 UTSW 19 6519257 missense probably damaging 1.00
R3943:Nrxn2 UTSW 19 6473335 missense probably damaging 1.00
R4091:Nrxn2 UTSW 19 6473414 missense probably damaging 1.00
R4162:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4164:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4495:Nrxn2 UTSW 19 6531399 missense probably benign 0.05
R4599:Nrxn2 UTSW 19 6455252 missense probably damaging 0.98
R4735:Nrxn2 UTSW 19 6498454 missense possibly damaging 0.86
R4757:Nrxn2 UTSW 19 6509821 missense probably damaging 1.00
R4890:Nrxn2 UTSW 19 6448278 missense possibly damaging 0.90
R5052:Nrxn2 UTSW 19 6455204 missense probably damaging 1.00
R5311:Nrxn2 UTSW 19 6531398 missense probably benign 0.05
R5330:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5331:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5530:Nrxn2 UTSW 19 6498367 missense possibly damaging 0.93
R5556:Nrxn2 UTSW 19 6490091 missense probably damaging 1.00
R5763:Nrxn2 UTSW 19 6531339 missense probably benign 0.15
R5829:Nrxn2 UTSW 19 6490849 missense probably benign 0.03
R5988:Nrxn2 UTSW 19 6492871 missense possibly damaging 0.83
R6003:Nrxn2 UTSW 19 6498328 missense possibly damaging 0.93
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6288:Nrxn2 UTSW 19 6490561 missense probably damaging 1.00
R6334:Nrxn2 UTSW 19 6531292 splice site probably null
R6373:Nrxn2 UTSW 19 6509830 missense probably damaging 1.00
R6397:Nrxn2 UTSW 19 6532122 missense probably damaging 1.00
R6669:Nrxn2 UTSW 19 6481191 missense probably damaging 1.00
R6980:Nrxn2 UTSW 19 6450579 missense probably benign 0.04
R7184:Nrxn2 UTSW 19 6490552 missense probably damaging 1.00
R7361:Nrxn2 UTSW 19 6517082 missense probably benign 0.00
R7576:Nrxn2 UTSW 19 6531510 nonsense probably null
R7604:Nrxn2 UTSW 19 6531961 missense probably damaging 1.00
R7631:Nrxn2 UTSW 19 6481795 missense possibly damaging 0.83
R7768:Nrxn2 UTSW 19 6481379 missense possibly damaging 0.69
R7805:Nrxn2 UTSW 19 6531706 missense probably benign
R7896:Nrxn2 UTSW 19 6532053 missense possibly damaging 0.89
R7998:Nrxn2 UTSW 19 6509875 missense probably damaging 0.98
R8383:Nrxn2 UTSW 19 6472313 missense probably damaging 1.00
R8505:Nrxn2 UTSW 19 6490133 missense probably damaging 1.00
X0022:Nrxn2 UTSW 19 6509917 missense probably damaging 1.00
Z1177:Nrxn2 UTSW 19 6498517 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGACACCCCTTTTCAGACTTG -3'
(R):5'- AGTCACAGACGAACCGGTTC -3'

Sequencing Primer
(F):5'- GTGACTTCCCTCCACACTGAG -3'
(R):5'- GTTCCAGCCCTCTCGACAGATG -3'
Posted On2018-11-28