Incidental Mutation 'R6986:Nckap1'
ID542948
Institutional Source Beutler Lab
Gene Symbol Nckap1
Ensembl Gene ENSMUSG00000027002
Gene NameNCK-associated protein 1
Synonymsmh19, Hem-2, Nap1, Hem2, H19
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location80500512-80581380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80520567 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 726 (Y726F)
Ref Sequence ENSEMBL: ENSMUSP00000028386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028386] [ENSMUST00000111760]
Predicted Effect probably benign
Transcript: ENSMUST00000028386
AA Change: Y726F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028386
Gene: ENSMUSG00000027002
AA Change: Y726F

DomainStartEndE-ValueType
Pfam:Nckap1 8 1124 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111760
AA Change: Y732F

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107390
Gene: ENSMUSG00000027002
AA Change: Y732F

DomainStartEndE-ValueType
Pfam:Nckap1 9 1128 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth arrest at midgestation, an open neural tube, cardia bifida, defective foregut development, defects in endoderm and mesoderm migration and sometimes duplication of the anteroposterior body axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Nckap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nckap1 APN 2 80506202 missense possibly damaging 0.87
IGL00896:Nckap1 APN 2 80580953 missense possibly damaging 0.59
IGL01343:Nckap1 APN 2 80519842 missense possibly damaging 0.81
IGL01593:Nckap1 APN 2 80520570 missense probably benign 0.06
IGL01677:Nckap1 APN 2 80530297 missense probably benign 0.04
IGL01873:Nckap1 APN 2 80553385 missense possibly damaging 0.95
IGL01874:Nckap1 APN 2 80525636 missense probably damaging 1.00
IGL01947:Nckap1 APN 2 80508753 missense probably damaging 1.00
IGL02268:Nckap1 APN 2 80528618 missense probably benign 0.16
IGL02348:Nckap1 APN 2 80517982 missense probably damaging 1.00
IGL03349:Nckap1 APN 2 80525560 missense probably benign 0.07
PIT4151001:Nckap1 UTSW 2 80520370 critical splice donor site probably null
R0326:Nckap1 UTSW 2 80553370 missense probably benign 0.41
R0345:Nckap1 UTSW 2 80544977 splice site probably benign
R0520:Nckap1 UTSW 2 80541530 splice site probably benign
R0603:Nckap1 UTSW 2 80512729 missense probably benign 0.19
R0924:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0930:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0964:Nckap1 UTSW 2 80547899 critical splice donor site probably null
R1122:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1123:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1124:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1125:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1127:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1182:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1234:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1236:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1384:Nckap1 UTSW 2 80533670 missense possibly damaging 0.90
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1511:Nckap1 UTSW 2 80553415 missense probably damaging 0.99
R1677:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1686:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1687:Nckap1 UTSW 2 80520585 missense probably damaging 0.96
R1717:Nckap1 UTSW 2 80512670 splice site probably benign
R1789:Nckap1 UTSW 2 80520556 missense probably benign 0.44
R1822:Nckap1 UTSW 2 80517898 missense possibly damaging 0.58
R1840:Nckap1 UTSW 2 80502250 missense possibly damaging 0.88
R1926:Nckap1 UTSW 2 80506838 missense probably damaging 1.00
R1968:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1970:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R2027:Nckap1 UTSW 2 80535518 missense probably damaging 1.00
R2063:Nckap1 UTSW 2 80570150 missense probably damaging 1.00
R2504:Nckap1 UTSW 2 80530218 missense probably benign 0.40
R3824:Nckap1 UTSW 2 80540560 missense possibly damaging 0.72
R4784:Nckap1 UTSW 2 80506934 missense probably benign 0.15
R4908:Nckap1 UTSW 2 80523374 critical splice donor site probably null
R5077:Nckap1 UTSW 2 80548933 missense probably damaging 0.99
R5311:Nckap1 UTSW 2 80540122 missense probably damaging 1.00
R5439:Nckap1 UTSW 2 80512690 missense possibly damaging 0.81
R6141:Nckap1 UTSW 2 80530207 missense probably damaging 1.00
R6209:Nckap1 UTSW 2 80525602 missense probably damaging 1.00
R6226:Nckap1 UTSW 2 80508781 missense possibly damaging 0.96
R6294:Nckap1 UTSW 2 80541514 missense probably benign 0.03
R6458:Nckap1 UTSW 2 80512549 intron probably null
R6937:Nckap1 UTSW 2 80508716 missense probably damaging 1.00
R7180:Nckap1 UTSW 2 80506892 missense probably benign 0.01
R7208:Nckap1 UTSW 2 80540198 missense probably benign 0.24
R7363:Nckap1 UTSW 2 80540168 missense probably damaging 1.00
R7448:Nckap1 UTSW 2 80524541 missense probably damaging 1.00
R7513:Nckap1 UTSW 2 80502291 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACAGACTCGTGATGGTTGG -3'
(R):5'- GCAGCAGTGCCAAATAAATTTAAGC -3'

Sequencing Primer
(F):5'- GGTTCTCCATGGCTGTCTAAG -3'
(R):5'- GGACTTGCAAACTTTATATGCCCCAG -3'
Posted On2018-11-28