Incidental Mutation 'R6986:Tuft1'
ID542955
Institutional Source Beutler Lab
Gene Symbol Tuft1
Ensembl Gene ENSMUSG00000005968
Gene Nametuftelin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94612757-94658872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94614154 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 358 (P358S)
Ref Sequence ENSEMBL: ENSMUSP00000143278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006123] [ENSMUST00000196655] [ENSMUST00000196733]
Predicted Effect probably damaging
Transcript: ENSMUST00000006123
AA Change: P383S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006123
Gene: ENSMUSG00000005968
AA Change: P383S

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
coiled coil region 164 347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196655
AA Change: P328S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142537
Gene: ENSMUSG00000005968
AA Change: P328S

DomainStartEndE-ValueType
coiled coil region 109 292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196733
AA Change: P358S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143278
Gene: ENSMUSG00000005968
AA Change: P358S

DomainStartEndE-ValueType
coiled coil region 63 100 N/A INTRINSIC
coiled coil region 139 322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Tuftelin is an acidic protein that is thought to play a role in dental enamel mineralization and is implicated in caries susceptibility. It is also thought to be involved with adaptation to hypoxia, mesenchymal stem cell function, and neurotrophin nerve growth factor mediated neuronal differentiation. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Tuft1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Tuft1 APN 3 94622784 missense possibly damaging 0.96
IGL00816:Tuft1 APN 3 94615831 missense probably damaging 0.99
IGL01339:Tuft1 APN 3 94628287 missense probably damaging 0.99
IGL01364:Tuft1 APN 3 94635503 splice site probably benign
IGL02012:Tuft1 APN 3 94622155 unclassified probably benign
IGL02332:Tuft1 APN 3 94615768 critical splice donor site probably null
IGL02400:Tuft1 APN 3 94635502 splice site probably benign
IGL03155:Tuft1 APN 3 94634514 missense possibly damaging 0.78
R4246:Tuft1 UTSW 3 94614801 missense probably benign 0.00
R4911:Tuft1 UTSW 3 94635443 missense probably damaging 0.97
R5261:Tuft1 UTSW 3 94639405 missense possibly damaging 0.83
R6622:Tuft1 UTSW 3 94635419 missense probably damaging 1.00
R6639:Tuft1 UTSW 3 94632623 missense probably benign
R6790:Tuft1 UTSW 3 94628230 missense possibly damaging 0.92
X0022:Tuft1 UTSW 3 94635428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCTGCAGTGTCCTGAG -3'
(R):5'- ACCTCTCAGTTGTGTAACTACTATC -3'

Sequencing Primer
(F):5'- TCTGCAGTGTCCTGAGGAGAC -3'
(R):5'- CTTTATCACCCTTGACACCTCAGGAG -3'
Posted On2018-11-28