Incidental Mutation 'R6986:Ints8'
ID542958
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Nameintegrator complex subunit 8
Synonyms2810013E07Rik, D130008D20Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location11199158-11254258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11204474 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 994 (Y994C)
Ref Sequence ENSEMBL: ENSMUSP00000103955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029866] [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319] [ENSMUST00000108324] [ENSMUST00000170901]
Predicted Effect probably benign
Transcript: ENSMUST00000029866
SMART Domains Protein: ENSMUSP00000029866
Gene: ENSMUSG00000028212

DomainStartEndE-ValueType
CYCLIN 146 231 2.16e-24 SMART
Cyclin_C 240 362 5.49e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000044616
AA Change: Y994C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: Y994C

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108318
AA Change: Y977C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: Y977C

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108319
AA Change: Y994C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: Y994C

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108324
SMART Domains Protein: ENSMUSP00000103960
Gene: ENSMUSG00000028212

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170901
SMART Domains Protein: ENSMUSP00000130693
Gene: ENSMUSG00000028212

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11218679 splice site probably benign
IGL01925:Ints8 APN 4 11235617 splice site probably benign
IGL02195:Ints8 APN 4 11221222 missense probably damaging 1.00
IGL02215:Ints8 APN 4 11209244 missense probably damaging 1.00
IGL02429:Ints8 APN 4 11231720 missense probably damaging 1.00
IGL02484:Ints8 APN 4 11208834 nonsense probably null
IGL02558:Ints8 APN 4 11218771 missense probably damaging 1.00
IGL02725:Ints8 APN 4 11239406 missense probably benign 0.01
IGL02742:Ints8 APN 4 11241627 missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11245896 missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11235565 missense probably damaging 1.00
IGL03171:Ints8 APN 4 11231702 missense probably benign 0.01
IGL03335:Ints8 APN 4 11216460 missense probably damaging 1.00
P0026:Ints8 UTSW 4 11225788 nonsense probably null
R0054:Ints8 UTSW 4 11204595 utr 3 prime probably benign
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0063:Ints8 UTSW 4 11252857 missense probably damaging 1.00
R0184:Ints8 UTSW 4 11218637 missense probably benign 0.03
R0299:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0499:Ints8 UTSW 4 11246097 missense probably benign 0.04
R0540:Ints8 UTSW 4 11252926 missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11246097 missense probably benign 0.04
R1232:Ints8 UTSW 4 11234587 missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11221204 missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11239461 missense probably benign 0.22
R1503:Ints8 UTSW 4 11245842 missense probably damaging 0.97
R1587:Ints8 UTSW 4 11245722 critical splice donor site probably null
R1701:Ints8 UTSW 4 11231656 missense probably damaging 1.00
R1721:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1757:Ints8 UTSW 4 11254109 start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11225600 critical splice donor site probably null
R1867:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1868:Ints8 UTSW 4 11241684 missense probably damaging 0.97
R1952:Ints8 UTSW 4 11221150 missense probably benign 0.21
R2084:Ints8 UTSW 4 11230377 missense probably benign 0.31
R2108:Ints8 UTSW 4 11235552 missense probably damaging 0.99
R2202:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11225712 missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11225725 missense probably benign 0.29
R2504:Ints8 UTSW 4 11241642 missense probably benign 0.03
R3824:Ints8 UTSW 4 11225621 nonsense probably null
R4664:Ints8 UTSW 4 11227152 missense probably benign 0.04
R4703:Ints8 UTSW 4 11223785 missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11230367 nonsense probably null
R5206:Ints8 UTSW 4 11216477 missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11211916 missense probably damaging 1.00
R5505:Ints8 UTSW 4 11221143 missense probably benign 0.18
R5513:Ints8 UTSW 4 11248303 missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11241654 missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11223813 missense probably damaging 1.00
R6007:Ints8 UTSW 4 11208845 missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11252891 missense probably damaging 1.00
R6466:Ints8 UTSW 4 11252878 missense probably damaging 0.99
R6709:Ints8 UTSW 4 11221117 missense possibly damaging 0.65
R6998:Ints8 UTSW 4 11204537 missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11204574 missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11225613 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCATGAACCTTGTCTCTC -3'
(R):5'- AAAAGTGGATCAATGTGATGCC -3'

Sequencing Primer
(F):5'- GGCATGAACCTTGTCTCTCTTTGAAG -3'
(R):5'- AACTTTGAGTTATGTGTACTACTGTG -3'
Posted On2018-11-28