Mutagenetix > Incidental Mutations

Incidental Mutation 'R6986:Agbl3'

542968

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6986 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34839452 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 766 (K766E)

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably benign
Transcript: ENSMUST00000115016
AA Change: K771E

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: K771E

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: K766E

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: K766E

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 98.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	T	C	16: 4,311,577	N482D	probably damaging	Het
Aldh3a1	T	A	11: 61,214,251	I154N	probably damaging	Het
Cdca2	C	T	14: 67,694,997	V486I	probably benign	Het
Celf3	G	C	3: 94,487,717	A313P	possibly damaging	Het
Cgrrf1	T	C	14: 46,832,129		probably benign	Het
Chd7	T	A	4: 8,859,285	N2458K	possibly damaging	Het
Chrna5	T	A	9: 55,006,457	M429K	possibly damaging	Het
Cux2	A	T	5: 121,868,579	L876Q	possibly damaging	Het
Cyb5rl	T	A	4: 107,070,876	S3T	probably benign	Het
Ehd4	A	T	2: 120,097,090	M321K	probably damaging	Het
Ell2	C	A	13: 75,761,887	L119M	probably damaging	Het
Endod1	T	C	9: 14,357,310	E293G	probably damaging	Het
Fam205c	A	G	4: 42,868,696	V309A	possibly damaging	Het
Fat3	G	A	9: 16,021,335	T1434I	probably damaging	Het
Flrt2	T	A	12: 95,780,685	I599N	probably damaging	Het
Gm6370	T	A	5: 146,493,588		probably null	Het
Gm7247	T	C	14: 51,365,375	M56T	possibly damaging	Het
Herc2	G	A	7: 56,106,453	R747H	possibly damaging	Het
Hist1h3g	A	G	13: 23,535,433		probably benign	Het
Ints8	T	C	4: 11,204,474	Y994C	probably damaging	Het
Irf1	A	G	11: 53,774,140	T165A	probably damaging	Het
Lgr6	G	T	1: 134,993,956	Q217K	possibly damaging	Het
Lrrc36	T	C	8: 105,458,447	S619P	probably damaging	Het
Marc2	T	C	1: 184,841,263	H53R	probably benign	Het
Morn4	T	C	19: 42,078,014	N45D	possibly damaging	Het
Mtmr3	T	C	11: 4,489,692	T583A	probably damaging	Het
Ncdn	A	G	4: 126,747,229	Y493H	probably damaging	Het
Nckap1	T	A	2: 80,520,567	Y726F	probably benign	Het
Olfr225	A	G	11: 59,614,098	K378R	possibly damaging	Het
Olfr822	G	A	10: 130,075,330	V307M	possibly damaging	Het
Optc	T	A	1: 133,897,964	M275L	probably benign	Het
Perm1	A	T	4: 156,218,519	K507*	probably null	Het
Pgbd5	C	T	8: 124,384,473	E160K	possibly damaging	Het
Polr2k	C	A	15: 36,175,035	P14T	probably benign	Het
Ppp2r3d	A	T	9: 124,439,080	Y112*	probably null	Het
Pramef17	T	A	4: 143,993,318	D159V	probably damaging	Het
Rnase9	T	C	14: 51,039,080	N147S	probably benign	Het
Rnls	C	T	19: 33,382,381	G11D	probably damaging	Het
Sbf2	T	C	7: 110,330,615	T333A	probably damaging	Het
Scn3a	A	T	2: 65,508,618	N572K	probably damaging	Het
Serinc3	A	G	2: 163,627,971	L319P	probably benign	Het
Setbp1	T	C	18: 78,857,839	D871G	probably damaging	Het
Sf3b2	T	C	19: 5,279,895	T661A	probably benign	Het
Sgsm2	T	A	11: 74,892,041	R30W	probably damaging	Het
Sh3tc1	A	G	5: 35,723,944	S52P	probably benign	Het
Smox	C	T	2: 131,522,111	A45V	possibly damaging	Het
Snrpa	A	T	7: 27,192,964	M57K	probably damaging	Het
Srbd1	A	T	17: 85,985,222	I973N	probably damaging	Het
Srp72	T	A	5: 76,994,876	S428T	probably benign	Het
Ss18l2	A	G	9: 121,712,605	Y50C	probably damaging	Het
St14	A	G	9: 31,096,549	L578P	probably damaging	Het
Tcrg-V6	G	T	13: 19,190,644	G40W	possibly damaging	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmc1	T	C	19: 20,824,283	N460D	probably benign	Het
Tnni3k	C	T	3: 154,961,864	G280R	probably damaging	Het
Trpc3	A	G	3: 36,655,016		probably null	Het
Tshr	C	T	12: 91,533,957	A152V	probably damaging	Het
Tuft1	G	A	3: 94,614,154	P358S	probably damaging	Het
Vmn2r120	A	T	17: 57,509,340	S672T	probably damaging	Het
Vmn2r83	G	T	10: 79,480,259	E496D	probably benign	Het
Vmn2r91	A	G	17: 18,136,009	N646S	probably benign	Het
Zfp9	A	G	6: 118,464,465	V412A	possibly damaging	Het
Zmynd8	G	T	2: 165,833,415	H273N	probably damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAAGTATGTGACACTGAGATGAC -3'
(R):5'- AAGTTCCTTGGCTGTAGAGTAG -3'

Sequencing Primer
(F):5'- TGTGACACTGAGATGACAATACTC -3'
(R):5'- GAGGGCAATGGTTATTAATCCCCC -3'

Posted On

2018-11-28