Incidental Mutation 'R6986:Agbl3'
ID 542968
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene Name ATP/GTP binding protein-like 3
Synonyms 4930431N21Rik, 2900053G10Rik, 6530406M24Rik
MMRRC Submission 045093-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6986 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 34780432-34859459 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34839452 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 766 (K766E)
Ref Sequence ENSEMBL: ENSMUSP00000110669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]
AlphaFold Q8CDP0
Predicted Effect probably benign
Transcript: ENSMUST00000115016
AA Change: K771E

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: K771E

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115017
AA Change: K766E

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: K766E

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 (GRCm38) N482D probably damaging Het
Aldh3a1 T A 11: 61,214,251 (GRCm38) I154N probably damaging Het
Cdca2 C T 14: 67,694,997 (GRCm38) V486I probably benign Het
Celf3 G C 3: 94,487,717 (GRCm38) A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 (GRCm38) probably benign Het
Chd7 T A 4: 8,859,285 (GRCm38) N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 (GRCm38) M429K possibly damaging Het
Cux2 A T 5: 121,868,579 (GRCm38) L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 (GRCm38) S3T probably benign Het
Ehd4 A T 2: 120,097,090 (GRCm38) M321K probably damaging Het
Ell2 C A 13: 75,761,887 (GRCm38) L119M probably damaging Het
Endod1 T C 9: 14,357,310 (GRCm38) E293G probably damaging Het
Fam205c A G 4: 42,868,696 (GRCm38) V309A possibly damaging Het
Fat3 G A 9: 16,021,335 (GRCm38) T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 (GRCm38) I599N probably damaging Het
Gm6370 T A 5: 146,493,588 (GRCm38) probably null Het
Gm7247 T C 14: 51,365,375 (GRCm38) M56T possibly damaging Het
Herc2 G A 7: 56,106,453 (GRCm38) R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 (GRCm38) probably benign Het
Ints8 T C 4: 11,204,474 (GRCm38) Y994C probably damaging Het
Irf1 A G 11: 53,774,140 (GRCm38) T165A probably damaging Het
Lgr6 G T 1: 134,993,956 (GRCm38) Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 (GRCm38) S619P probably damaging Het
Marc2 T C 1: 184,841,263 (GRCm38) H53R probably benign Het
Morn4 T C 19: 42,078,014 (GRCm38) N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 (GRCm38) T583A probably damaging Het
Ncdn A G 4: 126,747,229 (GRCm38) Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 (GRCm38) Y726F probably benign Het
Olfr225 A G 11: 59,614,098 (GRCm38) K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 (GRCm38) V307M possibly damaging Het
Optc T A 1: 133,897,964 (GRCm38) M275L probably benign Het
Perm1 A T 4: 156,218,519 (GRCm38) K507* probably null Het
Pgbd5 C T 8: 124,384,473 (GRCm38) E160K possibly damaging Het
Polr2k C A 15: 36,175,035 (GRCm38) P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 (GRCm38) Y112* probably null Het
Pramef17 T A 4: 143,993,318 (GRCm38) D159V probably damaging Het
Rnase9 T C 14: 51,039,080 (GRCm38) N147S probably benign Het
Rnls C T 19: 33,382,381 (GRCm38) G11D probably damaging Het
Sbf2 T C 7: 110,330,615 (GRCm38) T333A probably damaging Het
Scn3a A T 2: 65,508,618 (GRCm38) N572K probably damaging Het
Serinc3 A G 2: 163,627,971 (GRCm38) L319P probably benign Het
Setbp1 T C 18: 78,857,839 (GRCm38) D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 (GRCm38) T661A probably benign Het
Sgsm2 T A 11: 74,892,041 (GRCm38) R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 (GRCm38) S52P probably benign Het
Smox C T 2: 131,522,111 (GRCm38) A45V possibly damaging Het
Snrpa A T 7: 27,192,964 (GRCm38) M57K probably damaging Het
Srbd1 A T 17: 85,985,222 (GRCm38) I973N probably damaging Het
Srp72 T A 5: 76,994,876 (GRCm38) S428T probably benign Het
Ss18l2 A G 9: 121,712,605 (GRCm38) Y50C probably damaging Het
St14 A G 9: 31,096,549 (GRCm38) L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 (GRCm38) G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 (GRCm38) E732K probably benign Het
Tmc1 T C 19: 20,824,283 (GRCm38) N460D probably benign Het
Tnni3k C T 3: 154,961,864 (GRCm38) G280R probably damaging Het
Trpc3 A G 3: 36,655,016 (GRCm38) probably null Het
Tshr C T 12: 91,533,957 (GRCm38) A152V probably damaging Het
Tuft1 G A 3: 94,614,154 (GRCm38) P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 (GRCm38) S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 (GRCm38) E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 (GRCm38) N646S probably benign Het
Zfp9 A G 6: 118,464,465 (GRCm38) V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 (GRCm38) H273N probably damaging Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34,846,836 (GRCm38) missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34,799,732 (GRCm38) missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34,799,159 (GRCm38) missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34,799,887 (GRCm38) missense probably benign 0.40
IGL01123:Agbl3 APN 6 34,846,976 (GRCm38) nonsense probably null
IGL01707:Agbl3 APN 6 34,839,454 (GRCm38) missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34,782,157 (GRCm38) start codon destroyed probably null
IGL02335:Agbl3 APN 6 34,799,750 (GRCm38) missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34,785,307 (GRCm38) missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34,823,071 (GRCm38) missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34,799,822 (GRCm38) missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34,857,659 (GRCm38) missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34,803,500 (GRCm38) missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34,799,899 (GRCm38) missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34,839,335 (GRCm38) missense probably benign
R0639:Agbl3 UTSW 6 34,799,705 (GRCm38) missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34,799,204 (GRCm38) missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34,803,451 (GRCm38) missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34,828,235 (GRCm38) missense probably benign 0.14
R1589:Agbl3 UTSW 6 34,857,517 (GRCm38) missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34,832,505 (GRCm38) missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34,846,764 (GRCm38) missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34,823,087 (GRCm38) splice site probably null
R3237:Agbl3 UTSW 6 34,823,087 (GRCm38) splice site probably null
R3420:Agbl3 UTSW 6 34,793,965 (GRCm38) missense probably benign 0.36
R3421:Agbl3 UTSW 6 34,793,965 (GRCm38) missense probably benign 0.36
R3422:Agbl3 UTSW 6 34,793,965 (GRCm38) missense probably benign 0.36
R3810:Agbl3 UTSW 6 34,799,729 (GRCm38) missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34,799,729 (GRCm38) missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34,846,899 (GRCm38) missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34,857,598 (GRCm38) missense probably benign 0.00
R4687:Agbl3 UTSW 6 34,798,326 (GRCm38) missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34,785,284 (GRCm38) missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34,814,752 (GRCm38) missense probably benign 0.03
R5386:Agbl3 UTSW 6 34,799,196 (GRCm38) missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34,803,573 (GRCm38) missense probably benign 0.21
R6018:Agbl3 UTSW 6 34,799,255 (GRCm38) missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34,857,753 (GRCm38) missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34,782,210 (GRCm38) missense unknown
R6525:Agbl3 UTSW 6 34,803,594 (GRCm38) nonsense probably null
R6546:Agbl3 UTSW 6 34,799,299 (GRCm38) missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34,846,953 (GRCm38) missense probably benign 0.03
R7023:Agbl3 UTSW 6 34,814,769 (GRCm38) missense probably benign 0.02
R7411:Agbl3 UTSW 6 34,814,819 (GRCm38) missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34,814,414 (GRCm38) missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34,857,671 (GRCm38) missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34,832,508 (GRCm38) missense probably benign 0.11
R7743:Agbl3 UTSW 6 34,846,830 (GRCm38) missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34,839,365 (GRCm38) missense probably benign 0.00
R8033:Agbl3 UTSW 6 34,839,494 (GRCm38) missense possibly damaging 0.95
R8203:Agbl3 UTSW 6 34,799,479 (GRCm38) missense probably damaging 1.00
R8769:Agbl3 UTSW 6 34,857,614 (GRCm38) missense probably damaging 0.96
R9072:Agbl3 UTSW 6 34,799,452 (GRCm38) missense probably damaging 1.00
R9073:Agbl3 UTSW 6 34,799,452 (GRCm38) missense probably damaging 1.00
R9210:Agbl3 UTSW 6 34,798,242 (GRCm38) missense probably damaging 0.98
R9255:Agbl3 UTSW 6 34,812,905 (GRCm38) missense probably damaging 1.00
R9536:Agbl3 UTSW 6 34,846,926 (GRCm38) missense probably benign
R9560:Agbl3 UTSW 6 34,846,908 (GRCm38) missense possibly damaging 0.94
R9662:Agbl3 UTSW 6 34,832,533 (GRCm38) nonsense probably null
RF014:Agbl3 UTSW 6 34,799,358 (GRCm38) missense possibly damaging 0.53
Z1177:Agbl3 UTSW 6 34,799,408 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAGTATGTGACACTGAGATGAC -3'
(R):5'- AAGTTCCTTGGCTGTAGAGTAG -3'

Sequencing Primer
(F):5'- TGTGACACTGAGATGACAATACTC -3'
(R):5'- GAGGGCAATGGTTATTAATCCCCC -3'
Posted On 2018-11-28