Incidental Mutation 'R6986:St14'
ID542977
Institutional Source Beutler Lab
Gene Symbol St14
Ensembl Gene ENSMUSG00000031995
Gene Namesuppression of tumorigenicity 14 (colon carcinoma)
SynonymsMT-SP1, matriptase, Tmprss14, Prss14, Epithin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location31089402-31131853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31096549 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 578 (L578P)
Ref Sequence ENSEMBL: ENSMUSP00000034478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034478]
Predicted Effect probably damaging
Transcript: ENSMUST00000034478
AA Change: L578P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995
AA Change: L578P

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
Pfam:SEA 88 181 7.9e-17 PFAM
CUB 214 334 4.24e-14 SMART
CUB 340 447 4.37e-25 SMART
LDLa 452 486 2.31e-9 SMART
LDLa 487 523 4.08e-10 SMART
LDLa 524 561 3.98e-13 SMART
LDLa 566 604 1.48e-7 SMART
Tryp_SPc 614 849 1.25e-93 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in St14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:St14 APN 9 31103779 missense probably damaging 1.00
IGL01443:St14 APN 9 31100193 nonsense probably null
IGL01816:St14 APN 9 31108267 missense possibly damaging 0.71
IGL02100:St14 APN 9 31100130 splice site probably benign
IGL02494:St14 APN 9 31108645 missense possibly damaging 0.47
IGL02588:St14 APN 9 31090033 splice site probably benign
IGL02663:St14 APN 9 31100382 splice site probably null
IGL02711:St14 APN 9 31089900 missense probably benign 0.05
IGL03130:St14 APN 9 31097071 critical splice donor site probably null
IGL03296:St14 APN 9 31108712 missense probably damaging 0.98
IGL03400:St14 APN 9 31096971 splice site probably benign
R0101:St14 UTSW 9 31097107 missense probably benign 0.23
R0225:St14 UTSW 9 31108284 critical splice acceptor site probably null
R0335:St14 UTSW 9 31091324 splice site probably benign
R0892:St14 UTSW 9 31100428 missense probably benign 0.38
R1334:St14 UTSW 9 31108210 missense probably damaging 1.00
R1487:St14 UTSW 9 31097180 missense probably damaging 1.00
R1521:St14 UTSW 9 31108215 missense probably benign 0.03
R1782:St14 UTSW 9 31100164 missense probably damaging 1.00
R1920:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1921:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1922:St14 UTSW 9 31089870 missense possibly damaging 0.94
R1933:St14 UTSW 9 31106212 missense probably benign 0.00
R2070:St14 UTSW 9 31091373 missense probably damaging 1.00
R2411:St14 UTSW 9 31108234 missense probably benign 0.13
R4152:St14 UTSW 9 31090506 missense probably benign 0.08
R4375:St14 UTSW 9 31090458 missense probably benign 0.02
R4419:St14 UTSW 9 31096928 missense probably damaging 1.00
R4747:St14 UTSW 9 31103757 missense possibly damaging 0.78
R4791:St14 UTSW 9 31095622 missense probably benign 0.27
R4915:St14 UTSW 9 31108664 nonsense probably null
R5056:St14 UTSW 9 31097551 splice site probably null
R5134:St14 UTSW 9 31095583 missense probably benign 0.00
R5241:St14 UTSW 9 31100418 nonsense probably null
R5325:St14 UTSW 9 31096978 splice site probably null
R5644:St14 UTSW 9 31106510 missense probably benign
R5828:St14 UTSW 9 31091507 missense probably damaging 1.00
R5922:St14 UTSW 9 31129904 intron probably benign
R5930:St14 UTSW 9 31103760 missense probably damaging 1.00
R5963:St14 UTSW 9 31106557 intron probably benign
R6911:St14 UTSW 9 31106785 missense probably benign 0.00
R6937:St14 UTSW 9 31129660 intron probably null
R7226:St14 UTSW 9 31100152 missense possibly damaging 0.63
R7395:St14 UTSW 9 31096899 missense probably benign 0.29
R7400:St14 UTSW 9 31108275 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CTGACATACTGCCTTCCCACAG -3'
(R):5'- AAGTCTGGGGAGAATCTTCCG -3'

Sequencing Primer
(F):5'- AGACAGATGTGCCCTCTGAGTG -3'
(R):5'- TGTGATGAATGGTGCCAG -3'
Posted On2018-11-28