Incidental Mutation 'R6986:Tshr'
ID542988
Institutional Source Beutler Lab
Gene Symbol Tshr
Ensembl Gene ENSMUSG00000020963
Gene Namethyroid stimulating hormone receptor
Synonymspet, hyt, hypothroid
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location91384563-91549808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91533957 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 152 (A152V)
Ref Sequence ENSEMBL: ENSMUSP00000152158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021346] [ENSMUST00000186437] [ENSMUST00000221216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021346
AA Change: A254V

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: A254V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:LRR_5 53 153 9.5e-7 PFAM
Pfam:LRR_5 148 244 5.1e-5 PFAM
Pfam:7tm_1 431 678 2.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186437
SMART Domains Protein: ENSMUSP00000139632
Gene: ENSMUSG00000020963

DomainStartEndE-ValueType
Pfam:7tm_1 1 86 6.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221216
AA Change: A152V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Tshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Tshr APN 12 91537500 missense probably damaging 1.00
IGL01503:Tshr APN 12 91511934 missense probably damaging 1.00
IGL01730:Tshr APN 12 91519303 missense possibly damaging 0.93
IGL02109:Tshr APN 12 91537992 missense probably damaging 1.00
IGL02199:Tshr APN 12 91538283 missense probably damaging 1.00
IGL02439:Tshr APN 12 91537547 missense probably damaging 0.97
IGL02696:Tshr APN 12 91493329 missense possibly damaging 0.72
IGL03170:Tshr APN 12 91537869 missense probably damaging 1.00
IGL03208:Tshr APN 12 91533942 missense probably damaging 1.00
freckle UTSW 12 91538226 nonsense probably null
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0067:Tshr UTSW 12 91505283 missense probably damaging 1.00
R0419:Tshr UTSW 12 91537869 missense probably damaging 1.00
R0658:Tshr UTSW 12 91538226 nonsense probably null
R0724:Tshr UTSW 12 91538286 missense probably damaging 1.00
R1170:Tshr UTSW 12 91538097 missense probably damaging 1.00
R1188:Tshr UTSW 12 91502168 missense probably benign 0.00
R1548:Tshr UTSW 12 91534031 missense probably damaging 1.00
R1677:Tshr UTSW 12 91537341 missense possibly damaging 0.81
R1808:Tshr UTSW 12 91537316 missense probably benign 0.00
R1934:Tshr UTSW 12 91537181 missense probably damaging 0.99
R3980:Tshr UTSW 12 91537743 missense probably damaging 1.00
R4008:Tshr UTSW 12 91537494 missense probably benign 0.21
R4828:Tshr UTSW 12 91537790 missense probably damaging 1.00
R4903:Tshr UTSW 12 91401188 missense probably benign 0.09
R4958:Tshr UTSW 12 91538187 missense probably damaging 1.00
R5528:Tshr UTSW 12 91537193 missense probably damaging 1.00
R5949:Tshr UTSW 12 91537218 missense probably damaging 1.00
R6136:Tshr UTSW 12 91538234 missense probably benign 0.34
R6147:Tshr UTSW 12 91538235 missense possibly damaging 0.84
R6454:Tshr UTSW 12 91538549 missense probably benign 0.33
R6572:Tshr UTSW 12 91538360 missense probably benign 0.29
R6884:Tshr UTSW 12 91538102 missense probably damaging 1.00
R7403:Tshr UTSW 12 91497774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTAATCTCAGAACCGTTTGAC -3'
(R):5'- GGATGCTTGCAGCTCTTTCC -3'

Sequencing Primer
(F):5'- ATCTCAGAACCGTTTGACTGGAG -3'
(R):5'- ATGAATGACTCCATCTCCCATCATGG -3'
Posted On2018-11-28