Incidental Mutation 'R6987:Trp53bp2'
ID543009
Institutional Source Beutler Lab
Gene Symbol Trp53bp2
Ensembl Gene ENSMUSG00000026510
Gene Nametransformation related protein 53 binding protein 2
Synonyms53BP2, ASPP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location182409172-182462432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 182446635 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 615 (Y615F)
Ref Sequence ENSEMBL: ENSMUSP00000112508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117245]
Predicted Effect probably damaging
Transcript: ENSMUST00000117245
AA Change: Y615F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112508
Gene: ENSMUSG00000026510
AA Change: Y615F

DomainStartEndE-ValueType
PDB:2UWQ|A 4 89 1e-53 PDB
Blast:RA 10 91 7e-50 BLAST
coiled coil region 129 306 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
low complexity region 495 512 N/A INTRINSIC
PDB:4IRV|H 728 788 5e-25 PDB
low complexity region 865 890 N/A INTRINSIC
ANK 964 993 2.52e-6 SMART
ANK 997 1026 7.13e-6 SMART
SH3 1066 1124 6.2e-13 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation is lethal by 30 days of age, although majority die embryonically. Heterozygotes show increased susceptibility to spontaneous and induced tumors of the lymphoma and sarcoma types [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Trp53bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Trp53bp2 APN 1 182440976 missense probably benign 0.17
IGL00920:Trp53bp2 APN 1 182444654 unclassified probably benign
IGL01336:Trp53bp2 APN 1 182431583 missense probably damaging 1.00
IGL01760:Trp53bp2 APN 1 182448428 missense possibly damaging 0.68
IGL02539:Trp53bp2 APN 1 182448691 missense probably damaging 0.99
IGL02609:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02720:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02962:Trp53bp2 APN 1 182431595 missense probably benign 0.00
IGL03348:Trp53bp2 APN 1 182453748 missense probably damaging 1.00
Nosa UTSW 1 182455740 missense probably damaging 1.00
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0347:Trp53bp2 UTSW 1 182441648 missense probably benign 0.08
R1422:Trp53bp2 UTSW 1 182446464 missense probably benign
R1833:Trp53bp2 UTSW 1 182429016 missense probably damaging 0.98
R1845:Trp53bp2 UTSW 1 182458903 missense probably damaging 1.00
R1893:Trp53bp2 UTSW 1 182431628 missense probably benign 0.01
R1927:Trp53bp2 UTSW 1 182452664 missense probably damaging 0.98
R2017:Trp53bp2 UTSW 1 182449015 missense probably benign
R2020:Trp53bp2 UTSW 1 182442819 missense probably damaging 1.00
R2072:Trp53bp2 UTSW 1 182458867 missense probably benign 0.00
R2120:Trp53bp2 UTSW 1 182441639 missense probably benign 0.06
R2504:Trp53bp2 UTSW 1 182441639 missense probably benign 0.26
R2970:Trp53bp2 UTSW 1 182431598 missense probably damaging 1.00
R3051:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3052:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3053:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3151:Trp53bp2 UTSW 1 182428960 missense probably damaging 1.00
R4043:Trp53bp2 UTSW 1 182449061 missense possibly damaging 0.93
R4757:Trp53bp2 UTSW 1 182458774 missense probably benign 0.04
R4785:Trp53bp2 UTSW 1 182448997 missense probably benign
R4817:Trp53bp2 UTSW 1 182441805 critical splice donor site probably null
R4836:Trp53bp2 UTSW 1 182431582 missense probably damaging 1.00
R5040:Trp53bp2 UTSW 1 182444706 missense probably damaging 1.00
R5882:Trp53bp2 UTSW 1 182442212 missense possibly damaging 0.87
R6007:Trp53bp2 UTSW 1 182455740 missense probably damaging 1.00
R6356:Trp53bp2 UTSW 1 182448997 missense probably benign
R6886:Trp53bp2 UTSW 1 182429043 critical splice donor site probably null
R7026:Trp53bp2 UTSW 1 182442735 missense probably benign
R7141:Trp53bp2 UTSW 1 182448508 missense
R7363:Trp53bp2 UTSW 1 182444666 missense probably damaging 0.99
R7452:Trp53bp2 UTSW 1 182446568 nonsense probably null
R7816:Trp53bp2 UTSW 1 182448695 missense probably damaging 0.99
R7838:Trp53bp2 UTSW 1 182455819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGATGCTGCTGTCTCCTG -3'
(R):5'- GTAGCTTGGCATAGGACTTAAGC -3'

Sequencing Primer
(F):5'- TGGTGCCCCTTCAGGTG -3'
(R):5'- AGCCTGAGTCCTATCCTTGGAG -3'
Posted On2018-11-28