Incidental Mutation 'R6987:Pla2g4e'
ID543013
Institutional Source Beutler Lab
Gene Symbol Pla2g4e
Ensembl Gene ENSMUSG00000050211
Gene Namephospholipase A2, group IVE
SynonymsPla2epsilon, 2310026J01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120166412-120245335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120186380 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 227 (A227T)
Ref Sequence ENSEMBL: ENSMUSP00000087525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090071]
Predicted Effect probably benign
Transcript: ENSMUST00000090071
AA Change: A227T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211
AA Change: A227T

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
C2 82 182 3.42e-14 SMART
low complexity region 191 207 N/A INTRINSIC
PLAc 311 818 5.17e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Pla2g4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pla2g4e APN 2 120185238 missense probably benign
IGL01712:Pla2g4e APN 2 120189403 critical splice donor site probably null
IGL01859:Pla2g4e APN 2 120182733 missense possibly damaging 0.70
IGL02334:Pla2g4e APN 2 120187236 missense probably benign
FR4737:Pla2g4e UTSW 2 120244724 small deletion probably benign
R0157:Pla2g4e UTSW 2 120170181 missense probably benign 0.00
R0578:Pla2g4e UTSW 2 120244681 splice site probably benign
R0675:Pla2g4e UTSW 2 120200198 splice site probably benign
R1278:Pla2g4e UTSW 2 120168470 critical splice donor site probably null
R1346:Pla2g4e UTSW 2 120182772 missense probably damaging 1.00
R1760:Pla2g4e UTSW 2 120170046 missense possibly damaging 0.50
R1773:Pla2g4e UTSW 2 120244721 missense probably benign
R1792:Pla2g4e UTSW 2 120168474 missense probably damaging 1.00
R2129:Pla2g4e UTSW 2 120182811 missense probably damaging 0.99
R2160:Pla2g4e UTSW 2 120185206 missense probably benign 0.00
R2191:Pla2g4e UTSW 2 120191199 frame shift probably null
R3901:Pla2g4e UTSW 2 120168604 missense probably benign 0.00
R4342:Pla2g4e UTSW 2 120186446 intron probably benign
R4414:Pla2g4e UTSW 2 120182713 missense probably benign
R4460:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4581:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4599:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4601:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4610:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4611:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4664:Pla2g4e UTSW 2 120171188 missense probably damaging 0.97
R4688:Pla2g4e UTSW 2 120167933 missense possibly damaging 0.82
R4691:Pla2g4e UTSW 2 120174300 missense probably damaging 1.00
R4944:Pla2g4e UTSW 2 120171237 missense probably benign 0.01
R5051:Pla2g4e UTSW 2 120174304 missense probably damaging 1.00
R5285:Pla2g4e UTSW 2 120189504 missense probably damaging 1.00
R5373:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5374:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5505:Pla2g4e UTSW 2 120244775 missense probably benign 0.08
R5702:Pla2g4e UTSW 2 120188511 missense possibly damaging 0.61
R6300:Pla2g4e UTSW 2 120182738 missense probably benign 0.00
R6711:Pla2g4e UTSW 2 120171270 missense probably benign 0.00
R6920:Pla2g4e UTSW 2 120185314 missense possibly damaging 0.82
R6961:Pla2g4e UTSW 2 120174370 splice site probably null
R7028:Pla2g4e UTSW 2 120170195 missense probably damaging 1.00
R7138:Pla2g4e UTSW 2 120171278 missense probably damaging 1.00
R7300:Pla2g4e UTSW 2 120191199 missense probably damaging 1.00
R7355:Pla2g4e UTSW 2 120181501 missense possibly damaging 0.91
R7502:Pla2g4e UTSW 2 120174338 synonymous probably null
R7849:Pla2g4e UTSW 2 120185322 missense probably benign 0.32
R7932:Pla2g4e UTSW 2 120185322 missense probably benign 0.32
RF044:Pla2g4e UTSW 2 120244724 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGATCCCTGGAAGAACAAAC -3'
(R):5'- GTCTACACCAAGCCCAGTAG -3'

Sequencing Primer
(F):5'- GACGTCTGAAGACACGATTTTG -3'
(R):5'- GGTGGCTTGAACTTAGAG -3'
Posted On2018-11-28