Incidental Mutation 'R6987:Elavl4'
ID 543016
Institutional Source Beutler Lab
Gene Symbol Elavl4
Ensembl Gene ENSMUSG00000028546
Gene Name ELAV like RNA binding protein 4
Synonyms Hud
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock # R6987 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 110203722-110351909 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110251405 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 55 (D55E)
Ref Sequence ENSEMBL: ENSMUSP00000121828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102722] [ENSMUST00000102723] [ENSMUST00000106597] [ENSMUST00000106598] [ENSMUST00000106600] [ENSMUST00000106601] [ENSMUST00000106603] [ENSMUST00000138972] [ENSMUST00000142722] [ENSMUST00000153906]
AlphaFold Q61701
Predicted Effect probably benign
Transcript: ENSMUST00000102722
AA Change: D47E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099783
Gene: ENSMUSG00000028546
AA Change: D47E

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 289 362 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102723
AA Change: D42E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099784
Gene: ENSMUSG00000028546
AA Change: D42E

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 298 371 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106597
AA Change: D47E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102207
Gene: ENSMUSG00000028546
AA Change: D47E

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 303 376 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106598
AA Change: D42E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102208
Gene: ENSMUSG00000028546
AA Change: D42E

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106600
AA Change: D59E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102210
Gene: ENSMUSG00000028546
AA Change: D59E

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
RRM 64 137 7.57e-24 SMART
RRM 150 225 1.35e-20 SMART
low complexity region 231 245 N/A INTRINSIC
RRM 301 374 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106601
AA Change: D42E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102212
Gene: ENSMUSG00000028546
AA Change: D42E

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106603
AA Change: D45E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102214
Gene: ENSMUSG00000028546
AA Change: D45E

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
RRM 50 123 7.57e-24 SMART
RRM 136 211 1.35e-20 SMART
low complexity region 217 231 N/A INTRINSIC
RRM 274 347 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138972
AA Change: D40E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123014
Gene: ENSMUSG00000028546
AA Change: D40E

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
RRM 45 118 7.57e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142722
AA Change: D55E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121828
Gene: ENSMUSG00000028546
AA Change: D55E

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
Pfam:RRM_1 61 92 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153906
AA Change: D40E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120942
Gene: ENSMUSG00000028546
AA Change: D40E

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:RRM_1 46 95 1.3e-14 PFAM
Pfam:RRM_6 46 95 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased neural progenitor self-renewal and impaired neuronal differentiation, partial penetrance of hind limb clasping, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Elavl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Elavl4 APN 4 110206612 missense probably benign 0.03
IGL01777:Elavl4 APN 4 110206661 critical splice acceptor site probably null
IGL02212:Elavl4 APN 4 110206412 missense probably damaging 1.00
IGL03053:Elavl4 APN 4 110251494 missense possibly damaging 0.89
R0386:Elavl4 UTSW 4 110206705 intron probably benign
R1141:Elavl4 UTSW 4 110251368 nonsense probably null
R1826:Elavl4 UTSW 4 110251292 missense probably damaging 1.00
R5155:Elavl4 UTSW 4 110292636 missense probably null 0.22
R5294:Elavl4 UTSW 4 110211430 missense possibly damaging 0.90
R5507:Elavl4 UTSW 4 110213206 missense probably benign 0.17
R5558:Elavl4 UTSW 4 110206603 missense probably benign 0.37
R5927:Elavl4 UTSW 4 110290243 unclassified probably benign
R5987:Elavl4 UTSW 4 110290644 missense probably benign 0.40
R6376:Elavl4 UTSW 4 110255454 start gained probably benign
R6504:Elavl4 UTSW 4 110255382 splice site probably null
R7278:Elavl4 UTSW 4 110211425 critical splice donor site probably null
R7431:Elavl4 UTSW 4 110226633 missense probably damaging 1.00
R7717:Elavl4 UTSW 4 110206466 missense probably damaging 1.00
R7979:Elavl4 UTSW 4 110211648 missense probably benign 0.12
R8516:Elavl4 UTSW 4 110251379 missense probably damaging 1.00
R8963:Elavl4 UTSW 4 110206579 missense probably damaging 1.00
R9216:Elavl4 UTSW 4 110251349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATCTGCTGTGAATCCC -3'
(R):5'- TGTGTTCACAGCCCAGTCTC -3'

Sequencing Primer
(F):5'- TCCCTAGCCTGAATGTTGAAGAGC -3'
(R):5'- ACAGCCCAGTCTCTCTGC -3'
Posted On 2018-11-28