Incidental Mutation 'R6987:Tmem168'
ID543018
Institutional Source Beutler Lab
Gene Symbol Tmem168
Ensembl Gene ENSMUSG00000029569
Gene Nametransmembrane protein 168
Synonyms5730526F17Rik, 8430437G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location13580687-13608100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13591477 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 63 (M63L)
Ref Sequence ENSEMBL: ENSMUSP00000145372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031554] [ENSMUST00000149123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031554
AA Change: M447L

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031554
Gene: ENSMUSG00000029569
AA Change: M447L

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 109 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 199 216 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
transmembrane domain 298 320 N/A INTRINSIC
transmembrane domain 359 378 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000149123
AA Change: M63L

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145372
Gene: ENSMUSG00000029569
AA Change: M63L

DomainStartEndE-ValueType
SCOP:d1jxqa_ 29 167 8e-3 SMART
Meta Mutation Damage Score 0.1668 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Tmem168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Tmem168 APN 6 13602675 missense probably benign 0.06
IGL01305:Tmem168 APN 6 13583046 missense probably damaging 1.00
IGL01843:Tmem168 APN 6 13582941 missense probably damaging 1.00
IGL02742:Tmem168 APN 6 13603262 missense probably benign 0.04
IGL02863:Tmem168 APN 6 13582918 missense probably damaging 0.98
ANU22:Tmem168 UTSW 6 13583046 missense probably damaging 1.00
R0193:Tmem168 UTSW 6 13583313 missense possibly damaging 0.81
R0537:Tmem168 UTSW 6 13603361 missense probably damaging 1.00
R0630:Tmem168 UTSW 6 13583065 missense probably benign
R0890:Tmem168 UTSW 6 13603272 missense probably damaging 1.00
R1416:Tmem168 UTSW 6 13591401 missense probably damaging 0.96
R1900:Tmem168 UTSW 6 13583071 missense probably benign 0.02
R3947:Tmem168 UTSW 6 13583052 missense probably damaging 1.00
R4362:Tmem168 UTSW 6 13595073 missense probably benign 0.31
R4620:Tmem168 UTSW 6 13594953 missense probably benign 0.03
R5693:Tmem168 UTSW 6 13602321 missense probably benign 0.01
R6142:Tmem168 UTSW 6 13591369 missense probably benign
R6328:Tmem168 UTSW 6 13602711 missense probably benign
R6438:Tmem168 UTSW 6 13602674 missense probably benign 0.06
R6711:Tmem168 UTSW 6 13603121 missense probably damaging 1.00
R6827:Tmem168 UTSW 6 13582838 missense probably damaging 0.99
R7696:Tmem168 UTSW 6 13602938 missense probably benign 0.01
R8295:Tmem168 UTSW 6 13602851 missense probably damaging 0.99
R8344:Tmem168 UTSW 6 13583325 missense probably benign
R8432:Tmem168 UTSW 6 13602536 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACAAAAGTAAACTTACCTGCGAGGG -3'
(R):5'- TACTGGTCATGCAAGACGAAG -3'

Sequencing Primer
(F):5'- ACTCTCCTGAGCCATGGGTG -3'
(R):5'- CTACTTTTGCAGCCCTGA -3'
Posted On2018-11-28