Incidental Mutation 'R6987:Vmn1r69'
ID543022
Institutional Source Beutler Lab
Gene Symbol Vmn1r69
Ensembl Gene ENSMUSG00000091662
Gene Namevomeronasal 1 receptor 69
SynonymsV1re9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location10578930-10613659 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 10580564 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000154473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163658] [ENSMUST00000176284] [ENSMUST00000176707] [ENSMUST00000226160] [ENSMUST00000226190] [ENSMUST00000226228] [ENSMUST00000227853] [ENSMUST00000228296] [ENSMUST00000228478] [ENSMUST00000228638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163658
AA Change: M80T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129646
Gene: ENSMUSG00000091662
AA Change: M80T

DomainStartEndE-ValueType
Pfam:V1R 50 307 3.3e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176284
AA Change: M80T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000176707
AA Change: M80T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226160
AA Change: M80T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226190
AA Change: M80T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226228
AA Change: M80T

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably null
Transcript: ENSMUST00000227853
AA Change: M1T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000228296
AA Change: M1T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000228478
AA Change: M1T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000228638
AA Change: M1T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.7274 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Olfr870 A T 9: 20,170,834 S246T probably benign Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Vmn1r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn1r69 APN 7 10579952 missense probably benign 0.00
IGL01972:Vmn1r69 APN 7 10580659 nonsense probably null
IGL02339:Vmn1r69 APN 7 10580718 nonsense probably null
IGL02424:Vmn1r69 APN 7 10580658 missense probably benign 0.00
IGL02602:Vmn1r69 APN 7 10579974 missense probably benign 0.14
IGL03271:Vmn1r69 APN 7 10580669 missense probably benign 0.11
R0034:Vmn1r69 UTSW 7 10580811 intron probably benign
R0052:Vmn1r69 UTSW 7 10580400 missense probably benign 0.00
R0096:Vmn1r69 UTSW 7 10580058 missense probably damaging 1.00
R0539:Vmn1r69 UTSW 7 10580947 splice site probably benign
R0604:Vmn1r69 UTSW 7 10580654 missense probably benign 0.00
R1681:Vmn1r69 UTSW 7 10580252 missense probably benign 0.06
R1884:Vmn1r69 UTSW 7 10580751 missense probably benign 0.00
R3741:Vmn1r69 UTSW 7 10580142 missense possibly damaging 0.47
R4655:Vmn1r69 UTSW 7 10580099 missense probably benign 0.03
R4735:Vmn1r69 UTSW 7 10580999 utr 5 prime probably benign
R4758:Vmn1r69 UTSW 7 10580546 missense probably benign 0.00
R5582:Vmn1r69 UTSW 7 10580508 missense probably damaging 1.00
R5966:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
R5977:Vmn1r69 UTSW 7 10580490 missense probably damaging 1.00
R6458:Vmn1r69 UTSW 7 10580438 missense probably benign
R7133:Vmn1r69 UTSW 7 10581068 intron probably benign
R7532:Vmn1r69 UTSW 7 10580354 missense probably damaging 0.98
R7878:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
R7961:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
Z1176:Vmn1r69 UTSW 7 10580096 missense not run
Predicted Primers PCR Primer
(F):5'- ACAAGGAGTAGCCAACGTAC -3'
(R):5'- TCGAAGATGGATTTCCGGAATC -3'

Sequencing Primer
(F):5'- GTAGCCAACGTACTTTGCAG -3'
(R):5'- GATTTCCGGAATCTGGCAATC -3'
Posted On2018-11-28