Incidental Mutation 'R6987:Olfr870'
ID543032
Institutional Source Beutler Lab
Gene Symbol Olfr870
Ensembl Gene ENSMUSG00000066899
Gene Nameolfactory receptor 870
SynonymsGA_x6K02T2PVTD-13912679-13911744, MOR141-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6987 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20168533-20174057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20170834 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 246 (S246T)
Ref Sequence ENSEMBL: ENSMUSP00000150084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086476] [ENSMUST00000215984]
Predicted Effect probably benign
Transcript: ENSMUST00000086476
AA Change: S246T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000091405
Gene: ENSMUSG00000066899
AA Change: S246T

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 1.8e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.8e-7 PFAM
Pfam:7tm_1 41 290 3.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215984
AA Change: S246T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A G 9: 70,722,696 I137V probably benign Het
Agtr1b A C 3: 20,316,421 I7S probably benign Het
Akt2 G T 7: 27,633,241 V215L probably damaging Het
Ccdc148 C A 2: 58,982,914 L294F probably damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Cldnd1 A G 16: 58,731,371 D121G probably benign Het
Cnr1 A G 4: 33,944,739 I376V probably benign Het
Cyp2c40 A G 19: 39,812,767 probably benign Het
Dnah8 A G 17: 30,662,091 I601V possibly damaging Het
Dnhd1 C A 7: 105,704,585 H2982N probably damaging Het
Elavl4 A T 4: 110,251,405 D55E possibly damaging Het
Enc1 T C 13: 97,245,636 I218T probably benign Het
Fbln2 T A 6: 91,234,229 V385D probably benign Het
Ffar2 A G 7: 30,819,683 V144A possibly damaging Het
Fsip2 C T 2: 82,948,286 Q159* probably null Het
Gm14548 A G 7: 3,897,661 I30T probably damaging Het
Golga4 A G 9: 118,558,532 H1574R probably benign Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Lama4 A G 10: 39,074,279 N985D probably benign Het
Lrp1 T C 10: 127,575,005 N1438S probably damaging Het
Masp1 C A 16: 23,513,915 V57F probably damaging Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Nos1 C T 5: 117,895,785 T324M probably benign Het
Npas3 A G 12: 54,068,253 K635E possibly damaging Het
Olfr481 C A 7: 108,081,131 C112* probably null Het
Osbp2 T C 11: 3,717,958 E13G probably damaging Het
Pkd1l1 A G 11: 8,902,575 M636T probably benign Het
Pla2g4e C T 2: 120,186,380 A227T probably benign Het
Prex2 C A 1: 11,170,752 A1028E probably damaging Het
Prr14 A G 7: 127,473,805 D49G possibly damaging Het
Slc9a9 A G 9: 94,669,990 probably benign Het
Sptb A G 12: 76,613,247 C960R probably benign Het
Taf15 C A 11: 83,484,695 T31K possibly damaging Het
Tdrd9 C A 12: 112,025,593 Q601K possibly damaging Het
Tes C A 6: 17,086,155 Q16K probably benign Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmem168 T A 6: 13,591,477 M63L possibly damaging Het
Trav14-1 C T 14: 53,554,459 R89* probably null Het
Trp53bp2 A T 1: 182,446,635 Y615F probably damaging Het
Ttc27 T C 17: 74,777,741 probably null Het
Usp25 T A 16: 77,077,180 V548E probably damaging Het
Vmn1r124 A T 7: 21,259,818 I267K probably benign Het
Vmn1r69 A G 7: 10,580,564 M1T probably null Het
Zfp729a T A 13: 67,619,939 K724* probably null Het
Zfp850 A T 7: 27,990,001 C261S probably damaging Het
Zfp882 T A 8: 71,914,673 V448E probably benign Het
Zzef1 A G 11: 72,855,514 M881V possibly damaging Het
Other mutations in Olfr870
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr870 APN 9 20171530 missense probably damaging 1.00
IGL01809:Olfr870 APN 9 20171295 missense probably damaging 1.00
IGL02130:Olfr870 APN 9 20171358 missense probably damaging 0.96
IGL03062:Olfr870 APN 9 20171167 missense probably damaging 1.00
IGL03133:Olfr870 APN 9 20170713 missense probably damaging 1.00
R0110:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0350:Olfr870 UTSW 9 20170736 nonsense probably null
R0417:Olfr870 UTSW 9 20171214 missense probably damaging 1.00
R0450:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0469:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R1169:Olfr870 UTSW 9 20171058 missense probably benign 0.04
R1728:Olfr870 UTSW 9 20170913 nonsense probably null
R1729:Olfr870 UTSW 9 20170913 nonsense probably null
R1776:Olfr870 UTSW 9 20170809 missense probably benign 0.16
R1784:Olfr870 UTSW 9 20170913 nonsense probably null
R1914:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1915:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1929:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R1936:Olfr870 UTSW 9 20171181 missense probably damaging 1.00
R2066:Olfr870 UTSW 9 20171554 missense probably benign 0.01
R2137:Olfr870 UTSW 9 20171167 missense probably damaging 1.00
R2221:Olfr870 UTSW 9 20171092 missense possibly damaging 0.86
R2270:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2271:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2272:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2509:Olfr870 UTSW 9 20171229 missense probably damaging 1.00
R2939:Olfr870 UTSW 9 20170765 missense probably benign
R2940:Olfr870 UTSW 9 20170765 missense probably benign
R3081:Olfr870 UTSW 9 20170765 missense probably benign
R4579:Olfr870 UTSW 9 20171114 missense probably damaging 1.00
R4667:Olfr870 UTSW 9 20171098 missense probably benign 0.04
R5681:Olfr870 UTSW 9 20170795 missense probably damaging 1.00
R5686:Olfr870 UTSW 9 20170969 missense possibly damaging 0.75
R5857:Olfr870 UTSW 9 20171239 missense probably damaging 1.00
R6561:Olfr870 UTSW 9 20170777 missense probably benign 0.01
R6842:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R7641:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R7674:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R8375:Olfr870 UTSW 9 20170741 missense probably benign 0.04
R8445:Olfr870 UTSW 9 20171098 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGTTCAGATGTCTAAAACCAGTG -3'
(R):5'- TAGCCTGCTCAGATACACTAATC -3'

Sequencing Primer
(F):5'- GTATTCTCCCAAGTGTTTTTAAGGC -3'
(R):5'- CATCCCTTTCTCAGGGAT -3'
Posted On2018-11-28