Mutagenetix > Incidental Mutations

Incidental Mutation 'R6987:Zzef1'

543041

Institutional Source

Beutler Lab

Gene Symbol

Zzef1

Ensembl Gene

ENSMUSG00000055670

Gene Name

zinc finger, ZZ-type with EF hand domain 1

Synonyms

C130099L13Rik, 8430405D05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6987 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72796226-72927120 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72855514 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 881 (M881V)

Ref Sequence

ENSEMBL: ENSMUSP00000068790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069395
AA Change: M881V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: M881V

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1122	1192	1.25e-7	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2657	2726	1.25e-7	PROSPERO
low complexity region	2840	2853	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172220
AA Change: M881V

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: M881V

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1006	1192	1.57e-16	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2583	2759	1.57e-16	PROSPERO
low complexity region	2873	2886	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207107
AA Change: M881V

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

Meta Mutation Damage Score

0.2171

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.9%

Validation Efficiency

100% (47/47)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	A	G	9: 70,722,696	I137V	probably benign	Het
Agtr1b	A	C	3: 20,316,421	I7S	probably benign	Het
Akt2	G	T	7: 27,633,241	V215L	probably damaging	Het
Ccdc148	C	A	2: 58,982,914	L294F	probably damaging	Het
Ccdc3	T	A	2: 5,138,304	V124E	possibly damaging	Het
Cldnd1	A	G	16: 58,731,371	D121G	probably benign	Het
Cnr1	A	G	4: 33,944,739	I376V	probably benign	Het
Cyp2c40	A	G	19: 39,812,767		probably benign	Het
Dnah8	A	G	17: 30,662,091	I601V	possibly damaging	Het
Dnhd1	C	A	7: 105,704,585	H2982N	probably damaging	Het
Elavl4	A	T	4: 110,251,405	D55E	possibly damaging	Het
Enc1	T	C	13: 97,245,636	I218T	probably benign	Het
Fbln2	T	A	6: 91,234,229	V385D	probably benign	Het
Ffar2	A	G	7: 30,819,683	V144A	possibly damaging	Het
Fsip2	C	T	2: 82,948,286	Q159*	probably null	Het
Gm14548	A	G	7: 3,897,661	I30T	probably damaging	Het
Golga4	A	G	9: 118,558,532	H1574R	probably benign	Het
Herc2	G	A	7: 56,106,453	R747H	possibly damaging	Het
Lama4	A	G	10: 39,074,279	N985D	probably benign	Het
Lrp1	T	C	10: 127,575,005	N1438S	probably damaging	Het
Masp1	C	A	16: 23,513,915	V57F	probably damaging	Het
Mypn	T	C	10: 63,193,131	E51G	probably benign	Het
Nos1	C	T	5: 117,895,785	T324M	probably benign	Het
Npas3	A	G	12: 54,068,253	K635E	possibly damaging	Het
Olfr481	C	A	7: 108,081,131	C112*	probably null	Het
Olfr870	A	T	9: 20,170,834	S246T	probably benign	Het
Osbp2	T	C	11: 3,717,958	E13G	probably damaging	Het
Pkd1l1	A	G	11: 8,902,575	M636T	probably benign	Het
Pla2g4e	C	T	2: 120,186,380	A227T	probably benign	Het
Prex2	C	A	1: 11,170,752	A1028E	probably damaging	Het
Prr14	A	G	7: 127,473,805	D49G	possibly damaging	Het
Slc9a9	A	G	9: 94,669,990		probably benign	Het
Sptb	A	G	12: 76,613,247	C960R	probably benign	Het
Taf15	C	A	11: 83,484,695	T31K	possibly damaging	Het
Tdrd9	C	A	12: 112,025,593	Q601K	possibly damaging	Het
Tes	C	A	6: 17,086,155	Q16K	probably benign	Het
Ticam1	C	T	17: 56,269,900	E732K	probably benign	Het
Tmem168	T	A	6: 13,591,477	M63L	possibly damaging	Het
Trav14-1	C	T	14: 53,554,459	R89*	probably null	Het
Trp53bp2	A	T	1: 182,446,635	Y615F	probably damaging	Het
Ttc27	T	C	17: 74,777,741		probably null	Het
Usp25	T	A	16: 77,077,180	V548E	probably damaging	Het
Vmn1r124	A	T	7: 21,259,818	I267K	probably benign	Het
Vmn1r69	A	G	7: 10,580,564	M1T	probably null	Het
Zfp729a	T	A	13: 67,619,939	K724*	probably null	Het
Zfp850	A	T	7: 27,990,001	C261S	probably damaging	Het
Zfp882	T	A	8: 71,914,673	V448E	probably benign	Het

Other mutations in Zzef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Zzef1	APN	11	72875126	missense	probably benign	0.02
IGL00898:Zzef1	APN	11	72875173	missense	probably benign	0.00
IGL00970:Zzef1	APN	11	72915245	missense	probably benign	0.06
IGL01062:Zzef1	APN	11	72874969	missense	probably benign
IGL01832:Zzef1	APN	11	72875066	missense	probably damaging	0.99
IGL02005:Zzef1	APN	11	72888299	missense	probably benign	0.00
IGL02026:Zzef1	APN	11	72881338	missense	probably benign	0.39
IGL02110:Zzef1	APN	11	72913112	missense	probably damaging	1.00
IGL02305:Zzef1	APN	11	72866597	splice site	probably benign
IGL02308:Zzef1	APN	11	72886747	missense	probably benign	0.04
IGL02315:Zzef1	APN	11	72875257	nonsense	probably null
IGL02332:Zzef1	APN	11	72916509	missense	probably benign	0.01
IGL02389:Zzef1	APN	11	72891217	missense	probably benign
IGL02389:Zzef1	APN	11	72899538	missense	possibly damaging	0.89
IGL02451:Zzef1	APN	11	72901388	missense	probably damaging	0.99
IGL02541:Zzef1	APN	11	72872649	missense	probably damaging	1.00
IGL02950:Zzef1	APN	11	72917699	splice site	probably benign
IGL02953:Zzef1	APN	11	72855398	missense	probably benign
IGL03053:Zzef1	APN	11	72831539	splice site	probably benign
IGL03085:Zzef1	APN	11	72855524	splice site	probably benign
IGL03152:Zzef1	APN	11	72923182	critical splice donor site	probably null
IGL03329:Zzef1	APN	11	72917273	splice site	probably benign
IGL03376:Zzef1	APN	11	72876551	splice site	probably benign
IGL03394:Zzef1	APN	11	72886775	splice site	probably null
Dreidel	UTSW	11	72908469	nonsense	probably null
Hanukkah	UTSW	11	72893332	missense	probably benign	0.00
Mezuzah	UTSW	11	72848733	nonsense	probably null
BB005:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
BB015:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
PIT4508001:Zzef1	UTSW	11	72895176	missense	probably benign
PIT4581001:Zzef1	UTSW	11	72899672	missense	probably benign	0.00
PIT4810001:Zzef1	UTSW	11	72850745	missense	probably damaging	1.00
R0094:Zzef1	UTSW	11	72817965	missense	probably benign	0.01
R0119:Zzef1	UTSW	11	72821851	missense	probably benign
R0136:Zzef1	UTSW	11	72821851	missense	probably benign
R0140:Zzef1	UTSW	11	72899551	missense	possibly damaging	0.70
R0212:Zzef1	UTSW	11	72873910	missense	possibly damaging	0.66
R0217:Zzef1	UTSW	11	72889068	missense	probably damaging	1.00
R0220:Zzef1	UTSW	11	72865966	missense	probably damaging	1.00
R0304:Zzef1	UTSW	11	72880624	missense	probably benign	0.10
R0400:Zzef1	UTSW	11	72895242	missense	probably damaging	1.00
R0422:Zzef1	UTSW	11	72866091	missense	possibly damaging	0.93
R0471:Zzef1	UTSW	11	72923111	missense	probably damaging	1.00
R0557:Zzef1	UTSW	11	72917730	missense	probably damaging	1.00
R0581:Zzef1	UTSW	11	72851900	missense	probably benign	0.00
R0599:Zzef1	UTSW	11	72913178	missense	probably damaging	1.00
R0603:Zzef1	UTSW	11	72818069	missense	probably benign	0.00
R0657:Zzef1	UTSW	11	72821851	missense	probably benign
R0987:Zzef1	UTSW	11	72901333	small deletion	probably benign
R1246:Zzef1	UTSW	11	72874909	missense	probably benign	0.00
R1327:Zzef1	UTSW	11	72893414	critical splice donor site	probably null
R1438:Zzef1	UTSW	11	72912945	missense	probably damaging	0.96
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1485:Zzef1	UTSW	11	72900809	splice site	probably null
R1556:Zzef1	UTSW	11	72915233	missense	probably damaging	1.00
R1563:Zzef1	UTSW	11	72848733	nonsense	probably null
R1584:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1643:Zzef1	UTSW	11	72826202	missense	probably damaging	1.00
R1646:Zzef1	UTSW	11	72864036	critical splice donor site	probably null
R1764:Zzef1	UTSW	11	72893332	missense	probably benign	0.00
R1777:Zzef1	UTSW	11	72910272	missense	probably damaging	1.00
R1793:Zzef1	UTSW	11	72886709	missense	probably damaging	1.00
R1900:Zzef1	UTSW	11	72848714	missense	probably damaging	0.99
R2096:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R2134:Zzef1	UTSW	11	72880624	missense	probably benign	0.02
R2157:Zzef1	UTSW	11	72848634	splice site	probably benign
R2183:Zzef1	UTSW	11	72886718	nonsense	probably null
R2192:Zzef1	UTSW	11	72910156	splice site	probably null
R2230:Zzef1	UTSW	11	72884416	missense	probably damaging	0.99
R2259:Zzef1	UTSW	11	72900633	nonsense	probably null
R2384:Zzef1	UTSW	11	72858394	missense	probably damaging	0.99
R2426:Zzef1	UTSW	11	72915265	missense	probably benign	0.01
R2915:Zzef1	UTSW	11	72910326	splice site	probably null
R3700:Zzef1	UTSW	11	72886772	missense	probably null	1.00
R3875:Zzef1	UTSW	11	72889040	missense	probably benign	0.22
R3902:Zzef1	UTSW	11	72908500	missense	probably damaging	1.00
R3927:Zzef1	UTSW	11	72858382	missense	probably damaging	1.00
R4086:Zzef1	UTSW	11	72875053	missense	probably benign	0.02
R4301:Zzef1	UTSW	11	72889035	missense	probably damaging	0.96
R4359:Zzef1	UTSW	11	72823508	missense	probably damaging	0.98
R4382:Zzef1	UTSW	11	72875112	missense	probably benign	0.00
R4453:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R4466:Zzef1	UTSW	11	72924659	missense	probably damaging	1.00
R4471:Zzef1	UTSW	11	72913331	missense	probably damaging	1.00
R4510:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4511:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4714:Zzef1	UTSW	11	72837212	missense	probably damaging	1.00
R4799:Zzef1	UTSW	11	72859623	missense	probably benign	0.12
R4906:Zzef1	UTSW	11	72901388	missense	probably damaging	1.00
R5075:Zzef1	UTSW	11	72858344	missense	probably damaging	1.00
R5357:Zzef1	UTSW	11	72843333	nonsense	probably null
R5579:Zzef1	UTSW	11	72900637	missense	probably damaging	0.98
R5598:Zzef1	UTSW	11	72916521	missense	probably damaging	1.00
R5725:Zzef1	UTSW	11	72855482	missense	possibly damaging	0.86
R5765:Zzef1	UTSW	11	72821937	nonsense	probably null
R5928:Zzef1	UTSW	11	72912852	missense	probably damaging	1.00
R6003:Zzef1	UTSW	11	72824065	splice site	probably null
R6047:Zzef1	UTSW	11	72866095	missense	probably damaging	0.99
R6224:Zzef1	UTSW	11	72855383	missense	probably damaging	0.99
R6225:Zzef1	UTSW	11	72869805	missense	possibly damaging	0.62
R6287:Zzef1	UTSW	11	72923112	missense	probably damaging	1.00
R6361:Zzef1	UTSW	11	72884349	missense	possibly damaging	0.93
R6451:Zzef1	UTSW	11	72923156	missense	possibly damaging	0.88
R6467:Zzef1	UTSW	11	72911264	critical splice donor site	probably null
R6484:Zzef1	UTSW	11	72895271	missense	probably damaging	1.00
R6493:Zzef1	UTSW	11	72913303	missense	probably benign	0.06
R6520:Zzef1	UTSW	11	72826065	missense	probably damaging	1.00
R6527:Zzef1	UTSW	11	72874990	missense	probably benign	0.00
R6540:Zzef1	UTSW	11	72913229	missense	probably damaging	1.00
R6608:Zzef1	UTSW	11	72912826	missense	probably damaging	1.00
R6795:Zzef1	UTSW	11	72850659	missense	probably benign	0.00
R6927:Zzef1	UTSW	11	72913157	missense	probably damaging	1.00
R7048:Zzef1	UTSW	11	72866699	nonsense	probably null
R7076:Zzef1	UTSW	11	72899559	missense	probably benign	0.00
R7099:Zzef1	UTSW	11	72872649	missense	possibly damaging	0.92
R7132:Zzef1	UTSW	11	72917871	critical splice donor site	probably null
R7175:Zzef1	UTSW	11	72851901	missense	possibly damaging	0.49
R7284:Zzef1	UTSW	11	72886690	missense	probably damaging	0.99
R7300:Zzef1	UTSW	11	72875004	missense	probably benign	0.02
R7486:Zzef1	UTSW	11	72864786	missense	possibly damaging	0.85
R7503:Zzef1	UTSW	11	72826067	missense	probably damaging	1.00
R7679:Zzef1	UTSW	11	72893278	missense	probably benign
R7874:Zzef1	UTSW	11	72859653	missense	probably benign	0.01
R7898:Zzef1	UTSW	11	72796547	missense	probably damaging	1.00
R7928:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
R8021:Zzef1	UTSW	11	72823416	missense	probably damaging	0.99
R8145:Zzef1	UTSW	11	72908469	nonsense	probably null
R8255:Zzef1	UTSW	11	72875129	missense	probably benign	0.00
R8303:Zzef1	UTSW	11	72917189	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72872604	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72886746	missense	probably damaging	0.97
R8498:Zzef1	UTSW	11	72853322	missense	probably damaging	1.00
R8547:Zzef1	UTSW	11	72844441	missense	probably damaging	1.00
R8874:Zzef1	UTSW	11	72863989	missense	probably benign	0.00
R8885:Zzef1	UTSW	11	72796576	missense	probably benign	0.00
R8972:Zzef1	UTSW	11	72900673	missense	probably damaging	1.00
R8979:Zzef1	UTSW	11	72875177	missense	probably benign	0.00
R9053:Zzef1	UTSW	11	72922476	missense	probably benign
R9108:Zzef1	UTSW	11	72899778	missense	probably benign	0.11
R9121:Zzef1	UTSW	11	72866120	nonsense	probably null
R9370:Zzef1	UTSW	11	72853322	missense	probably damaging	1.00
R9408:Zzef1	UTSW	11	72864827	missense	possibly damaging	0.86
X0028:Zzef1	UTSW	11	72906979	missense	probably benign	0.29
Z1176:Zzef1	UTSW	11	72796528	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72796312	missense	possibly damaging	0.91
Z1177:Zzef1	UTSW	11	72826178	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72900631	critical splice acceptor site	probably null
Z1177:Zzef1	UTSW	11	72915320	missense	probably damaging	1.00
Z1186:Zzef1	UTSW	11	72889182	missense	probably benign
Z1187:Zzef1	UTSW	11	72889182	missense	probably benign
Z1188:Zzef1	UTSW	11	72889182	missense	probably benign
Z1189:Zzef1	UTSW	11	72889182	missense	probably benign
Z1190:Zzef1	UTSW	11	72889182	missense	probably benign
Z1191:Zzef1	UTSW	11	72889182	missense	probably benign
Z1192:Zzef1	UTSW	11	72889182	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTCTGGTACAAAGGACAAAG -3'
(R):5'- AACTACACTGTGACTAAGCAAGAG -3'

Sequencing Primer
(F):5'- AAAGTGGAGAGTAGTGATTTGTAATC -3'
(R):5'- CTGTGACTAAGCAAGAGAATAAACTC -3'

Posted On

2018-11-28